Mutants (Isolated)

tm2974

Allele Nametm2974
Sequence NameW05B5.2
CGC NameW05B5.2
Worm BaseAllele Name tm2974
CGC Name W05B5.2
Sequence W05B5.2
Phenotypehomozygous viable
Mutation site24049/24050-24355/24356 (306 bp deletion)
ChromosomeI
Putative gene structurejoin(20852..20994, 21666..21813, 23781..23927, 23980..24094, 24139..24233, 24435..24589, 24845..24955, 25420..25654)
Map position17.18
Balancer
Map position of balancer
Sequence of primersExtRev:ACATAGCATCCGGACCGCTT,IntRev:TCGTATGCTGATTTGTCGGT,ExtFwd:AACGGAGAAACACGATGGTC,IntFwd:CAGCGCAACGCTCTCAACTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Mills H, Wragg R, Hapiak V, Castelletto M, Zahratka J, Harris G, Summers P, Korchnak A, Law W, Bamber B, Komuniecki R.
Monoamines and neuropeptides interact to inhibit aversive behaviour in Caenorhabditis elegans.
EMBO J. 2012 31(3) 667-78 
[ PubMed ID = 22124329 ] [ RRC reference ]

Harris G, Mills H, Wragg R, Hapiak V, Castelletto M, Korchnak A, Komuniecki RW.
The monoaminergic modulation of sensory-mediated aversive responses in Caenorhabditis elegans requires glutamatergic/peptidergic cotransmission.
J. Neurosci. 2010 30(23) 7889-99 
[ PubMed ID = 20534837 ] [ RRC reference ]

Hapiak V, Summers P, Ortega A, Law WJ, Stein A, Komuniecki R.
Neuropeptides amplify and focus the monoaminergic inhibition of nociception in Caenorhabditis elegans.
J. Neurosci. 2013 33(35) 14107-16 
[ PubMed ID = 23986246 ] [ RRC reference ]