Mutants (Isolated)

tm2966

Allele Nametm2966
Sequence NameY48B6A.11
CGC Namejmjd-2
Worm BaseAllele Name tm2966
CGC Name jmjd-2
Sequence Y48B6A.11
Phenotypehomozygous viable. Dr. M. Han: normal vulval phenotype.
Mutation site89670/89671-TNCACACACACCTTAATC-90343/90344 (673 bp deletion + 18 bp insertion)
ChromosomeII
Putative gene structurecomplement(join(86445..87456, 88264..88408, 89561..90651, 91314..91538, 93031..93242))
Map position22.9
Balancer
Map position of balancer
Sequence of primersIntFwd:GGTCTCAGCTGCCAATTGTG,ExtFwd:AAGCTCATCATAATCCGGTC,IntRev:GCCCGGAGCCTACTTCAAAC,ExtRev:CGGCCCGCGAAACAATCGAA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Greer EL, Becker B, Latza C, Antebi A, Shi Y.
Mutation of C. elegans demethylase spr-5 extends transgenerational longevity.
Cell Res 2016 26(2) 229-38 
[ PubMed ID = 26691751 ] [ RRC reference ]

Mutlu B, Chen HM, Gutnik S, Hall DH, Keppler-Ross S, Mango SE.
Distinct functions and temporal regulation of methylated histone H3 during early embryogenesis.
Development 2019 146(19)  
[ PubMed ID = 31540912 ] [ RRC reference ]

Kreher J, Takasaki T, Cockrum C, Sidoli S, Garcia BA, Jensen ON, Strome S.
Distinct Roles of Two Histone Methyltransferases in Transmitting H3K36me3-Based Epigenetic Memory Across Generations in Caenorhabditis elegans.
Genetics 2018 210(3) 969-982 
[ PubMed ID = 30217796 ] [ RRC reference ]

Black JC, Allen A, Van Rechem C, Forbes E, Longworth M, Tschöp K, Rinehart C, Quiton J, Walsh R, Smallwood A, Dyson NJ, Whetstine JR.
Conserved antagonism between JMJD2A/KDM4A and HP1γ during cell cycle progression.
Mol Cell 2010 40(5) 736-48 
[ PubMed ID = 21145482 ] [ RRC reference ]

Zheng C, Karimzadegan S, Chiang V, Chalfie M.
Histone methylation restrains the expression of subtype-specific genes during terminal neuronal differentiation in Caenorhabditis elegans.
PLoS Genet 2013 9(12) e1004017 
[ PubMed ID = 24348272 ] [ RRC reference ]

Greer EL, Beese-Sims SE, Brookes E, Spadafora R, Zhu Y, Rothbart SB, Aristizábal-Corrales D, Chen S, Badeaux AI, Jin Q, Wang W, Strahl BD, Colaiácovo MP, Shi Y.
A histone methylation network regulates transgenerational epigenetic memory in C. elegans.
Cell Rep 2014 7(1) 113-26 
[ PubMed ID = 24685137 ] [ RRC reference ]