Mutants (Isolated)

tm2966

Allele Nametm2966
Sequence NameY48B6A.11
CGC Namejmjd-2
Worm BaseAllele Name tm2966
CGC Name jmjd-2
Sequence Y48B6A.11
Phenotypehomozygous viable. Dr. M. Han: normal vulval phenotype.
Mutation site89670/89671-TNCACACACACCTTAATC-90343/90344 (673 bp deletion + 18 bp insertion)
ChromosomeII
Putative gene structurecomplement(join(86445..87456, 88264..88408, 89561..90651, 91314..91538, 93031..93242))
Map position22.9
Balancer
Map position of balancer
Sequence of primersIntFwd:GGTCTCAGCTGCCAATTGTG,ExtFwd:AAGCTCATCATAATCCGGTC,IntRev:GCCCGGAGCCTACTTCAAAC,ExtRev:CGGCCCGCGAAACAATCGAA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Black JC, Allen A, Van Rechem C, Forbes E, Longworth M, Tschöp K, Rinehart C, Quiton J, Walsh R, Smallwood A, Dyson NJ, Whetstine JR.
Conserved antagonism between JMJD2A/KDM4A and HP1γ during cell cycle progression.
Mol. Cell 2010 40(5) 736-48 
[ PubMed ID = 21145482 ] [ RRC reference ]

Zheng C, Karimzadegan S, Chiang V, Chalfie M.
Histone methylation restrains the expression of subtype-specific genes during terminal neuronal differentiation in Caenorhabditis elegans.
PLoS Genet. 2013 9(12) e1004017 
[ PubMed ID = 24348272 ] [ RRC reference ]

Greer EL, Beese-Sims SE, Brookes E, Spadafora R, Zhu Y, Rothbart SB, Aristizábal-Corrales D, Chen S, Badeaux AI, Jin Q, Wang W, Strahl BD, Colaiácovo MP, Shi Y.
A histone methylation network regulates transgenerational epigenetic memory in C. elegans.
Cell Rep 2014 7(1) 113-26 
[ PubMed ID = 24685137 ] [ RRC reference ]