Mutants (Isolated)

tm2948

Allele Nametm2948
Sequence NameR01H10.5
CGC NameR01H10.5
Worm BaseAllele Name tm2948
CGC Name R01H10.5
Sequence R01H10.5
Phenotypehomozygous viable
Mutation site12202/12203-12870/12871 (668 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(11671..11768, 12270..12384, 12435..12708, 13051..13193))
Map position2.1
Balancer
Map position of balancer
Sequence of primersExtFwd:ACCTCGGCGTTGTTCAGTGT,IntFwd:GTAGTACGCGAGGTGGCCTA,ExtRev:CCGATTCGTAACGGATTCAC,IntRev:GGCCACACTCAGAGTAGATC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
McClendon TB, Sullivan MR, Bernstein KA, Yanowitz JL.
Promotion of Homologous Recombination by SWS-1 in Complex with RAD-51 Paralogs in Caenorhabditis elegans.
Genetics 2016 203(1) 133-45 
[ PubMed ID = 26936927 ] [ RRC reference ]

Taylor MRG, Špírek M, Chaurasiya KR, Ward JD, Carzaniga R, Yu X, Egelman EH, Collinson LM, Rueda D, Krejci L, Boulton SJ.
Rad51 Paralogs Remodel Pre-synaptic Rad51 Filaments to Stimulate Homologous Recombination.
Cell 2015 162(2) 271-286 
[ PubMed ID = 26186187 ] [ RRC reference ]