Mutants (Isolated)

tm2940

Allele Nametm2940
Sequence NameT12A2.8
CGC NameT12A2.8
Worm BaseAllele Name tm2940
CGC Name T12A2.8
Sequence T12A2.8
Phenotypehomozygous viable. Dr. S. Boulton: not Him.
Mutation site29961/29962-TTTGTCGAAANCAACAT-30485/30486 (524 bp deletion + 17 bp insertion)
ChromosomeIII
Putative gene structurecomplement(join(28947..28998, 29158..29360, 29408..29591, 29641..29754, 29806..29971, 30026..30260, 30311..30400, 30455..30536, 30592..30682, 30729..30816))
Map position-1.41
Balancer
Map position of balancer
Sequence of primersExtFwd:GGCTTGAAGGCACTGCAATA,IntFwd:TCGCTTTCTGTCTGGAACCT,ExtRev:AACGGTGTGTAGTCGTGGCA,IntRev:GTCCCTCGTCGTCTCTCATG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Craig AL, Moser SC, Bailly AP, Gartner A.
Methods for studying the DNA damage response in the Caenorhabdatis elegans germ line.
Methods Cell Biol. 2012 107 321-52 
[ PubMed ID = 22226529 ] [ RRC reference ]

Bailly AP, Freeman A, Hall J, Déclais AC, Alpi A, Lilley DM, Ahmed S, Gartner A.
The Caenorhabditis elegans homolog of Gen1/Yen1 resolvases links DNA damage signaling to DNA double-strand break repair.
PLoS Genet. 2010 6(7) e1001025 
[ PubMed ID = 20661466 ] [ RRC reference ]

O'Neil NJ, Martin JS, Youds JL, Ward JD, Petalcorin MI, Rose AM, Boulton SJ.
Joint molecule resolution requires the redundant activities of MUS-81 and XPF-1 during Caenorhabditis elegans meiosis.
PLoS Genet. 2013 9(7) e1003582 
[ PubMed ID = 23874209 ] [ RRC reference ]

González-Huici V, Wang B, Gartner A.
A Role for the Nonsense-Mediated mRNA Decay Pathway in Maintaining Genome Stability in Caenorhabditis elegans.
Genetics 2017 206(4) 1853-1864 
[ PubMed ID = 28634159 ] [ RRC reference ]

Bertolini S, Wang B, Meier B, Hong Y, Gartner A.
Caenorhabditis elegans BUB-3 and SAN-1/MAD3 Spindle Assembly Checkpoint Components Are Required for Genome Stability in Response to Treatment with Ionizing Radiation.
G3 (Bethesda) 2017 7(12) 3875-3885 
[ PubMed ID = 29046436 ] [ RRC reference ]

Wilson DM 3rd, Rieckher M, Williams AB, Schumacher B.
Systematic analysis of DNA crosslink repair pathways during development and aging in Caenorhabditis elegans.
Nucleic Acids Res. 2017 45(16) 9467-9480 
[ PubMed ID = 28934497 ] [ RRC reference ]