Mutants (Isolated)

tm2940

Allele Nametm2940
Sequence NameT12A2.8
CGC NameT12A2.8
Worm BaseAllele Name tm2940
CGC Name T12A2.8
Sequence T12A2.8
Phenotypehomozygous viable. Dr. S. Boulton: not Him.
Mutation site29961/29962-TTTGTCGAAANCAACAT-30485/30486 (524 bp deletion + 17 bp insertion)
ChromosomeIII
Putative gene structurecomplement(join(28947..28998, 29158..29360, 29408..29591, 29641..29754, 29806..29971, 30026..30260, 30311..30400, 30455..30536, 30592..30682, 30729..30816))
Map position-1.41
Balancer
Map position of balancer
Sequence of primersExtFwd:GGCTTGAAGGCACTGCAATA,IntFwd:TCGCTTTCTGTCTGGAACCT,ExtRev:AACGGTGTGTAGTCGTGGCA,IntRev:GTCCCTCGTCGTCTCTCATG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Spatola BN, Lo JY, Wang B, Curran SP.
Nuclear and cytoplasmic WDR-23 isoforms mediate differential effects on GEN-1 and SKN-1 substrates.
Sci Rep 2019 9(1) 11783 
[ PubMed ID = 31409866 ] [ RRC reference ]

Craig AL, Moser SC, Bailly AP, Gartner A.
Methods for studying the DNA damage response in the Caenorhabdatis elegans germ line.
Methods Cell Biol 2012 107 321-52 
[ PubMed ID = 22226529 ] [ RRC reference ]

Bertolini S, Wang B, Meier B, Hong Y, Gartner A.
Caenorhabditis elegans BUB-3 and SAN-1/MAD3 Spindle Assembly Checkpoint Components Are Required for Genome Stability in Response to Treatment with Ionizing Radiation.
G3 (Bethesda) 2017 7(12) 3875-3885 
[ PubMed ID = 29046436 ] [ RRC reference ]

González-Huici V, Wang B, Gartner A.
A Role for the Nonsense-Mediated mRNA Decay Pathway in Maintaining Genome Stability in Caenorhabditis elegans.
Genetics 2017 206(4) 1853-1864 
[ PubMed ID = 28634159 ] [ RRC reference ]

O'Neil NJ, Martin JS, Youds JL, Ward JD, Petalcorin MI, Rose AM, Boulton SJ.
Joint molecule resolution requires the redundant activities of MUS-81 and XPF-1 during Caenorhabditis elegans meiosis.
PLoS Genet 2013 9(7) e1003582 
[ PubMed ID = 23874209 ] [ RRC reference ]

Ackermann L, Schell M, Pokrzywa W, Kevei É, Gartner A, Schumacher B, Hoppe T.
E4 ligase-specific ubiquitination hubs coordinate DNA double-strand-break repair and apoptosis.
Nat Struct Mol Biol 2016 23(11) 995-1002 
[ PubMed ID = 27669035 ] [ RRC reference ]

Wilson DM 3rd, Rieckher M, Williams AB, Schumacher B.
Systematic analysis of DNA crosslink repair pathways during development and aging in Caenorhabditis elegans.
Nucleic Acids Res 2017 45(16) 9467-9480 
[ PubMed ID = 28934497 ] [ RRC reference ]

Bailly AP, Freeman A, Hall J, Déclais AC, Alpi A, Lilley DM, Ahmed S, Gartner A.
The Caenorhabditis elegans homolog of Gen1/Yen1 resolvases links DNA damage signaling to DNA double-strand break repair.
PLoS Genet 2010 6(7) e1001025 
[ PubMed ID = 20661466 ] [ RRC reference ]