Mutants (Isolated)

tm2939

Allele Nametm2939
Sequence NameD2085.6
CGC Namepiga-1
Worm BaseAllele Name tm2939
CGC Name piga-1
Sequence D2085.6
Phenotypelethal or sterile
Mutation site20425/20426-20749/20750 (324 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(19430..19586, 19636..19819, 19879..20194, 20246..20611, 20728..20850, 20899..21055, 21112..21143))
Map position0.83
BalancermIn1
Map position of balancer
Sequence of primersIntRev:GTCCGTACAGTATTGCGTAA,ExtRev:GGGCGTCATTGCATCTGCAA,ExtFwd:TATGGGGGAGCATTCCGAGA,IntFwd:GACCATCTCCGCCAATTATG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Budirahardja Y, Doan TD, Zaidel-Bar R.
Glycosyl phosphatidylinositol anchor biosynthesis is essential for maintaining epithelial integrity during Caenorhabditis elegans embryogenesis.
PLoS Genet 2015 11(3) e1005082 
[ PubMed ID = 25807459 ] [ RRC reference ]

Murata D, Nomura KH, Dejima K, Mizuguchi S, Kawasaki N, Matsuishi-Nakajima Y, Ito S, Gengyo-Ando K, Kage-Nakadai E, Mitani S, Nomura K.
GPI-anchor synthesis is indispensable for the germline development of the nematode Caenorhabditis elegans.
Mol Biol Cell 2012 23(6) 982-95 
[ PubMed ID = 22298425 ] [ RRC reference ]

Ihara S, Nakayama S, Murakami Y, Suzuki E, Asakawa M, Kinoshita T, Sawa H.
PIGN prevents protein aggregation in the endoplasmic reticulum independently of its function in the GPI synthesis.
J Cell Sci 2017 130(3) 602-613 
[ PubMed ID = 27980068 ] [ RRC reference ]