Mutants (Isolated)

tm2937

Allele Nametm2937
Sequence NameK04B12.3
CGC Namesmg-8
Worm BaseAllele Name tm2937
CGC Name smg-8
Sequence K04B12.3
Phenotypehomozygous viable.
Mutation site26075/26076-A-26347/26348 (272 bp deletion + 1 bp insertion)
ChromosomeII
Putative gene structurejoin(26098..26178, 26224..26325, 26391..26647, 26695..26869, 27582..28121, 28651..29091, 29561..30058, 30601..31031, 31656..31800)
Map position23
Balancer
Map position of balancer
Sequence of primersIntFwd:GGCGTGTCAGTAGAGCGCAA,ExtRev:AAAGACCGTTGGGGCGCGAT,ExtFwd:ACTACGGCGTGTCAGTAGAG,IntRev:GGATTCACGTCTGGCCGGAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Rosains J, Mango SE.
Genetic characterization of smg-8 mutants reveals no role in C. elegans nonsense mediated decay.
PLoS ONE 2012 7(11) e49490 
[ PubMed ID = 23166684 ] [ RRC reference ]