Home > Mutants (Isolated) > tm2933

Mutants (Isolated)

Allele Name		tm2933
Allele Type		Normal
Sequence Name		C47C12.4
Gene Name		C47C12.4
Worm Base	Allele Name	tm2933
	Gene Name	C47C12.4
	Sequence	C47C12.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		14069/14070-GTGCTCTATAGCCA-14364/14365 (295 bp deletion + 14 bp insertion)
Chromosome		X
Putative gene structure		complement(join(13174..13341, 13401..13533, 13578..13965, 14016..14401, 14455..14551, 14603..14627))
Map position		-1.32
Balancer
Map position of balancer
Sequence of primers		IntFwd:GGTGTTGCAAACCAGCTAGA,ExtFwd:GGCTGCAGGTCAATTGACTC,IntRev:TGTCGTCTACTCGGTTACAG,ExtRev:CGAGTATCATGGACTTATCG
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Ding C, Wu Y, Dabas H, Hammarlund M. Activation of the CaMKII-Sarm1-ASK1-p38 MAP kinase pathway protects against axon degeneration caused by loss of mitochondria. Elife 2022 11   [ PubMed ID = 35285800 ] [ RRC reference ] Sure GR, Chatterjee A, Mishra N, Sabharwal V, Devireddy S, Awasthi A, Mohan S, Koushika SP. UNC-16/JIP3 and UNC-76/FEZ1 limit the density of mitochondria in C. elegans neurons by maintaining the balance of anterograde and retrograde mitochondrial transport. Sci Rep 2018 8(1) 8938  [ PubMed ID = 29895958 ] [ RRC reference ] Xu S, Wang Z, Kim KW, Jin Y, Chisholm AD. Targeted Mutagenesis of Duplicated Genes in Caenorhabditis elegans Using CRISPR-Cas9. J Genet Genomics 2016 43(2) 103-6  [ PubMed ID = 26924693 ] [ RRC reference ] Knowlton WM, Hubert T, Wu Z, Chisholm AD, Jin Y. A Select Subset of Electron Transport Chain Genes Associated with Optic Atrophy Link Mitochondria to Axon Regeneration in Caenorhabditis elegans. Front Neurosci 2017 11 263  [ PubMed ID = 28539870 ] [ RRC reference ]