Mutants (Isolated)

tm2927

Allele Nametm2927
Sequence NameC44C8.6a
CGC Namemak-2
Worm BaseAllele Name tm2927
CGC Name mak-2
Sequence C44C8.6a
Phenotypehomozygous viable.
Mutation site7942/7943-8532/8533 (590 bp deletion)
ChromosomeIV
Putative gene structurejoin(5151..5184, 5588..5663, 6684..6855, 7531..7910, 8315..8503, 8555..8679, 8800..9086, 10068..10136)
Map position-23.03
Balancer
Map position of balancer
Sequence of primersIntRev:CCTTACCGGACTAGCTCCAC,IntFwd:GGAATGTGAGCACCGCCAGT,ExtRev:CCTAACTCCCTTACCGGACT,ExtFwd:ACAGGTTCTCGGCGTAGGAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Yan D, Wu Z, Chisholm AD, Jin Y.
The DLK-1 kinase promotes mRNA stability and local translation in C. elegans synapses and axon regeneration.
Cell 2009 138(5) 1005-18 
[ PubMed ID = 19737525 ] [ RRC reference ]