Mutants (Isolated)

tm2926

Allele Nametm2926
BalanceNot Required
OutCrossNot Accepted
Sequence NameC54A12.4
Gene Namedrn-1
Worm BaseAllele Name tm2926
Gene Name drn-1
Sequence C54A12.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 28522/28523-28753/28754 (231 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(28688..28891, 29251..29365, 29419..29477))
Map position-1.81
Balancer
Map position of balancer
Sequence of primersExtFwd:AGGCAAACCGGGGTTATGGA,ExtRev:ACCGGGGTTATGGAGAAATC,IntFwd:CGCCAATAATGCTCGTTGGA,IntRev:CGGTACCTAAAACTCGCTCG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Reiner DJ, Lundquist EA.
Small GTPases.
WormBook 2018 2018 1-65 
[ PubMed ID = 27218782 ] [ RRC reference ]

Tada M, Gengyo-Ando K, Kobayashi T, Fukuyama M, Mitani S, Kontani K, Katada T.
Neuronally expressed Ras-family GTPase Di-Ras modulates synaptic activity in Caenorhabditis elegans.
Genes Cells 2012 17(9) 778-89 
[ PubMed ID = 22897658 ] [ RRC reference ]