Allele Name | tm2923 |
Sequence Name | Y46G5A.13 |
CGC Name | Y46G5A.13 |
Worm Base | Allele Name |
tm2923
|
CGC Name |
Y46G5A.13
|
Sequence |
Y46G5A.13
|
Phenotype | homozygous viable |
Mutation site | 88054/88055-88388/88389 (334 bp deletion) |
Chromosome | II |
Putative gene structure | join(88028..88152, 88214..88310, 88358..88453, 88543..88720, 89568..89873, 91063..91247, 92191..92508) |
Map position | 11.21 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtRev:ACCGCGAATAATTTTCGCCT,IntRev:CGCCTCAGAAACTTCTCCGA,ExtFwd:CGCTCCACCGGACAACTGAT,IntFwd:CTTCGTTCTACACGGGAGGT |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Huelgas-Morales G, Silva-García CG, Salinas LS, Greenstein D, Navarro RE. The Stress Granule RNA-Binding Protein TIAR-1 Protects Female Germ Cells from Heat Shock in Caenorhabditis elegans. G3 (Bethesda) 2016 6(4) 1031-47
[ PubMed ID = 26865701 ]
[ RRC reference ]
|
Silva-García CG, Estela Navarro R. The C. elegans TIA-1/TIAR homolog TIAR-1 is required to induce germ cell apoptosis. Genesis 2013 51(10) 690-707
[ PubMed ID = 23913578 ]
[ RRC reference ]
|
Rousakis A, Vlanti A, Borbolis F, Roumelioti F, Kapetanou M, Syntichaki P. Diverse functions of mRNA metabolism factors in stress defense and aging of Caenorhabditis elegans. PLoS One 2014 9(7) e103365
[ PubMed ID = 25061667 ]
[ RRC reference ]
|
|