Mutants (Isolated)

tm2923

Allele Nametm2923
Sequence NameY46G5A.13
CGC NameY46G5A.13
Worm BaseAllele Name tm2923
CGC Name Y46G5A.13
Sequence Y46G5A.13
Phenotypehomozygous viable
Mutation site88054/88055-88388/88389 (334 bp deletion)
ChromosomeII
Putative gene structurejoin(88028..88152, 88214..88310, 88358..88453, 88543..88720, 89568..89873, 91063..91247, 92191..92508)
Map position11.21
Balancer
Map position of balancer
Sequence of primersExtRev:ACCGCGAATAATTTTCGCCT,IntRev:CGCCTCAGAAACTTCTCCGA,ExtFwd:CGCTCCACCGGACAACTGAT,IntFwd:CTTCGTTCTACACGGGAGGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Huelgas-Morales G, Silva-García CG, Salinas LS, Greenstein D, Navarro RE.
The Stress Granule RNA-Binding Protein TIAR-1 Protects Female Germ Cells from Heat Shock in Caenorhabditis elegans.
G3 (Bethesda) 2016 6(4) 1031-47 
[ PubMed ID = 26865701 ] [ RRC reference ]

Silva-García CG, Estela Navarro R.
The C. elegans TIA-1/TIAR homolog TIAR-1 is required to induce germ cell apoptosis.
Genesis 2013 51(10) 690-707 
[ PubMed ID = 23913578 ] [ RRC reference ]

Rousakis A, Vlanti A, Borbolis F, Roumelioti F, Kapetanou M, Syntichaki P.
Diverse functions of mRNA metabolism factors in stress defense and aging of Caenorhabditis elegans.
PLoS One 2014 9(7) e103365 
[ PubMed ID = 25061667 ] [ RRC reference ]