Mutants (Isolated)

tm2921

Allele Nametm2921
Sequence NameZK121.1
CGC Nameglrx-21
Worm BaseAllele Name tm2921
CGC Name glrx-21
Sequence ZK121.1
Phenotypehomozygous viable
Mutation site6671/6672-GC-6995/6996 (324 bp deletion + 2 bp insertion)
ChromosomeIII
Putative gene structurecomplement(join(6227..6343, 6474..6668, 6878..6925))
Map position-1.78
Balancer
Map position of balancer
Sequence of primersExtRev:CTATCCACGACACACTGCAC,IntFwd:TCGGCGAATTCTCTCCCGTG,IntRev:ATTGAGGATCGTCTGAACAC,ExtFwd:TTGCGCGCCGAGACACATCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Morgan KL, Estevez AO, Mueller CL, Cacho-Valadez B, Miranda-Vizuete A, Szewczyk NJ, Estevez M.
The glutaredoxin GLRX-21 functions to prevent selenium-induced oxidative stress in Caenorhabditis elegans.
Toxicol. Sci. 2010 118(2) 530-43 
[ PubMed ID = 20833709 ] [ RRC reference ]

Estevez AO, Mueller CL, Morgan KL, Szewczyk NJ, Teece L, Miranda-Vizuete A, Estevez M.
Selenium induces cholinergic motor neuron degeneration in Caenorhabditis elegans.
Neurotoxicology 2012 33(5) 1021-32 
[ PubMed ID = 22560997 ] [ RRC reference ]