Mutants (Isolated)

tm292

Allele Nametm292
Sequence NameF40H3.4
CGC Namefkh-8
Worm BaseAllele Name tm292
CGC Name fkh-8
Sequence F40H3.4
Phenotypehomozygous viable. Dr. J. Kaplan: WT aldicarb response. Dr. O. Hobert: normal ASE development.
Mutation site22158/22159-22689/22690 (531 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(22008..22168, 22217..22316, 22416..22529, 22581..22663, 22713..22811, 22859..22928, 22974..23168, 23560..23670))
Map position-0.6
Balancer
Map position of balancer
Sequence of primersExtFwd:CACTTTCGCAGAAGAGGTAG,IntFwd:AAGAGACCTCCACAGCCATG,ExtRev:GAATCACTCTGTCGTGGATC,IntRev:CTCGTTGAGGTTTCGATGTT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Sieburth D, Ch'ng Q, Dybbs M, Tavazoie M, Kennedy S, Wang D, Dupuy D, Rual JF, Hill DE, Vidal M, Ruvkun G, Kaplan JM.
Systematic analysis of genes required for synapse structure and function.
Nature 2005 436(7050) 510-7 
[ PubMed ID = 16049479 ] [ RRC reference ]