Mutants (Isolated)

tm2913

Allele Nametm2913
Sequence NameY113G7A.5
CGC NameY113G7A.5
Worm BaseAllele Name tm2913
CGC Name Y113G7A.5
Sequence Y113G7A.5
Phenotypehomozygous viable.
Mutation site2603/2604-2900/2901 (297 bp deletion)
ChromosomeV
Putative gene structurejoin(AL117207.1:119131..119188, 417..527, 809..908, 2579..2756, 2833..3111, 3976..4107, 5132..5332, 6441..6553, 6684..6777, 7459..7623, 8794..8894, 10051..10135)
Map position24.36
Balancer
Map position of balancer
Sequence of primersIntRev:ATCAGGGGTGCTGAATCCAA,ExtRev:CTAGACTATATCAGGGGTGC,IntFwd:ATGGATAGCAGTGGCGCAGT,ExtFwd:CCTTTTTTCCCGCACCTTAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Collins KM, Bode A, Fernandez RW, Tanis JE, Brewer JC, Creamer MS, Koelle MR.
Activity of the C. elegans egg-laying behavior circuit is controlled by competing activation and feedback inhibition.
Elife 2016 5  
[ PubMed ID = 27849154 ] [ RRC reference ]

Fu J, Zhang H, Huang W, Zhu X, Sheng Y, Song E, Xu T.
AIM interneurons mediate feeding suppression through the TYRA-2 receptor in C. elegans.
Biophys Rep 2018 4(1) 17-24 
[ PubMed ID = 29577066 ] [ RRC reference ]

Maguire SM, Clark CM, Nunnari J, Pirri JK, Alkema MJ.
The C. elegans touch response facilitates escape from predacious fungi.
Curr. Biol. 2011 21(15) 1326-30 
[ PubMed ID = 21802299 ] [ RRC reference ]

Pirri JK, Rayes D, Alkema MJ.
A Change in the Ion Selectivity of Ligand-Gated Ion Channels Provides a Mechanism to Switch Behavior.
PLoS Biol. 2015 13(9) e1002238 
[ PubMed ID = 26348462 ] [ RRC reference ]

Safratowich BD, Hossain M, Bianchi L, Carvelli L.
Amphetamine potentiates the effects of β-phenylethylamine through activation of an amine-gated chloride channel.
J. Neurosci. 2014 34(13) 4686-91 
[ PubMed ID = 24672014 ] [ RRC reference ]

Donnelly JL, Clark CM, Leifer AM, Pirri JK, Haburcak M, Francis MM, Samuel AD, Alkema MJ.
Monoaminergic orchestration of motor programs in a complex C. elegans behavior.
PLoS Biol. 2013 11(4) e1001529 
[ PubMed ID = 23565061 ] [ RRC reference ]

Nagy S, Huang YC, Alkema MJ, Biron D.
Caenorhabditis elegans exhibit a coupling between the defecation motor program and directed locomotion.
Sci Rep 2015 5 17174 
[ PubMed ID = 26597056 ] [ RRC reference ]

Li Z, Li Y, Yi Y, Huang W, Yang S, Niu W, Zhang L, Xu Z, Qu A, Wu Z, Xu T.
Dissecting a central flip-flop circuit that integrates contradictory sensory cues in C. elegans feeding regulation.
Nat Commun 2012 3 776 
[ PubMed ID = 22491324 ] [ RRC reference ]

Law W, Wuescher LM, Ortega A, Hapiak VM, Komuniecki PR, Komuniecki R.
Heterologous Expression in Remodeled C. elegans: A Platform for Monoaminergic Agonist Identification and Anthelmintic Screening.
PLoS Pathog. 2015 11(4) e1004794 
[ PubMed ID = 25928899 ] [ RRC reference ]

Chew YL, Tanizawa Y, Cho Y, Zhao B, Yu AJ, Ardiel EL, Rabinowitch I, Bai J, Rankin CH, Lu H, Beets I, Schafer WR.
An Afferent Neuropeptide System Transmits Mechanosensory Signals Triggering Sensitization and Arousal in C. elegans.
Neuron 2018 99(6) 1233-1246.e6 
[ PubMed ID = 30146306 ] [ RRC reference ]

Karmacharya R, Lynn SK, Demarco S, Ortiz A, Wang X, Lundy MY, Xie Z, Cohen BM, Miller GM, Buttner EA.
Behavioral effects of clozapine: involvement of trace amine pathways in C. elegans and M. musculus.
Brain Res. 2011 1393 91-9 
[ PubMed ID = 21529784 ] [ RRC reference ]

Pirri JK, McPherson AD, Donnelly JL, Francis MM, Alkema MJ.
A tyramine-gated chloride channel coordinates distinct motor programs of a Caenorhabditis elegans escape response.
Neuron 2009 62(4) 526-38 
[ PubMed ID = 19477154 ] [ RRC reference ]