Home > Mutants (Isolated) > tm2912

Mutants (Isolated)

Allele Name		tm2912
Allele Type		Normal
Sequence Name		F02E8.3
Gene Name		aps-2
Worm Base	Allele Name	tm2912
	Gene Name	aps-2
	Sequence	F02E8.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		lethal or sterile. Dr. O. Blacque: could not assess Dyf phenotype due to lethality.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		11246/11247-11440/11441 (194 bp deletion)
Chromosome		X
Putative gene structure		join(10598..10684, 10736..10915, 11285..11446)
Map position		-7.58
Balancer
Map position of balancer
Sequence of primers		ExtRev:CTTAGAATACCTCCGGCAAC,ExtFwd:GCGGATTTCAGCTTTCCGCA,IntFwd:CCGCAAGGTCTTCGCTAAGT,IntRev:GAATACCTCCGGCAACATTG
Distributed lab
Depositor		Dr. S. Mitani
References		Please submit your publication Wang L, Audhya A. In vivo imaging of C. elegans endocytosis. Methods 2014 68(3) 518-28  [ PubMed ID = 24704355 ] [ RRC reference ] Hollopeter G, Lange JJ, Zhang Y, Vu TN, Gu M, Ailion M, Lambie EJ, Slaughter BD, Unruh JR, Florens L, Jorgensen EM. The membrane-associated proteins FCHo and SGIP are allosteric activators of the AP2 clathrin adaptor complex. Elife 2014 3   [ PubMed ID = 25303366 ] [ RRC reference ] Garafalo SD, Luth ES, Moss BJ, Monteiro MI, Malkin E, Juo P. The AP2 clathrin adaptor protein complex regulates the abundance of GLR-1 glutamate receptors in the ventral nerve cord of Caenorhabditis elegans. Mol Biol Cell 2015 26(10) 1887-900  [ PubMed ID = 25788288 ] [ RRC reference ] Kuwahara T, Koyama A, Koyama S, Yoshina S, Ren CH, Kato T, Mitani S, Iwatsubo T. A systematic RNAi screen reveals involvement of endocytic pathway in neuronal dysfunction in alpha-synuclein transgenic C. elegans. Hum Mol Genet 2008 17(19) 2997-3009  [ PubMed ID = 18617532 ] [ RRC reference ]