Mutants (Isolated)

tm2912

Allele Nametm2912
Sequence NameF02E8.3
CGC Nameaps-2
Worm BaseAllele Name tm2912
CGC Name aps-2
Sequence F02E8.3
Phenotypelethal or sterile. Dr. O. Blacque: could not assess Dyf phenotype due to lethality.
Mutation site11246/11247-11440/11441 (194 bp deletion)
ChromosomeX
Putative gene structurejoin(10598..10684, 10736..10915, 11285..11446)
Map position-7.58
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersExtRev:CTTAGAATACCTCCGGCAAC,ExtFwd:GCGGATTTCAGCTTTCCGCA,IntFwd:CCGCAAGGTCTTCGCTAAGT,IntRev:GAATACCTCCGGCAACATTG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Kuwahara T, Koyama A, Koyama S, Yoshina S, Ren CH, Kato T, Mitani S, Iwatsubo T.
A systematic RNAi screen reveals involvement of endocytic pathway in neuronal dysfunction in alpha-synuclein transgenic C. elegans.
Hum. Mol. Genet. 2008 17(19) 2997-3009 
[ PubMed ID = 18617532 ] [ RRC reference ]

Hollopeter G, Lange JJ, Zhang Y, Vu TN, Gu M, Ailion M, Lambie EJ, Slaughter BD, Unruh JR, Florens L, Jorgensen EM.
The membrane-associated proteins FCHo and SGIP are allosteric activators of the AP2 clathrin adaptor complex.
Elife 2014 3  
[ PubMed ID = 25303366 ] [ RRC reference ]

Wang L, Audhya A.
In vivo imaging of C. elegans endocytosis.
Methods 2014 68(3) 518-28 
[ PubMed ID = 24704355 ] [ RRC reference ]

Garafalo SD, Luth ES, Moss BJ, Monteiro MI, Malkin E, Juo P.
The AP2 clathrin adaptor protein complex regulates the abundance of GLR-1 glutamate receptors in the ventral nerve cord of Caenorhabditis elegans.
Mol. Biol. Cell 2015 26(10) 1887-900 
[ PubMed ID = 25788288 ] [ RRC reference ]