Mutants (Isolated)

tm2910

Allele Nametm2910
Sequence NameR02D3.2
CGC Namecogc-8
Worm BaseAllele Name tm2910
CGC Name cogc-8
Sequence R02D3.2
Phenotypelethal or sterile
Mutation site16454/16455-A-17217/17218 (763 bp deletion + 1 bp insertion)
ChromosomeIV
Putative gene structurejoin(15576..15639, 15686..15810, 15861..16031, 16083..16193, 16243..16446, 16500..16610, 16694..16812, 16941..17496, 18121..18891)
Map position-26.65
Balancerdpy-9 (e12) IV
Map position of balancer-26.77
Sequence of primersExtFwd:TACGGGCAGCCAACGCGATT,IntFwd:TATCGCCGATTTGCCTTTAC,ExtRev:CCGCTTAGAAATCGAGGATC,IntRev:CTAACAGTTGCCGGCGGGAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Yamamoto TG, Watanabe S, Essex A, Kitagawa R.
SPDL-1 functions as a kinetochore receptor for MDF-1 in Caenorhabditis elegans.
J. Cell Biol. 2008 183(2) 187-94 
[ PubMed ID = 18936247 ] [ RRC reference ]

Tarailo M, Tarailo S, Rose AM.
Synthetic lethal interactions identify phenotypic "interologs" of the spindle assembly checkpoint components.
Genetics 2007 177(4) 2525-30 
[ PubMed ID = 18073444 ] [ RRC reference ]