Mutants (Isolated)

tm291

Allele Nametm291
Sequence NameZC404.8
CGC Namespn-4
Worm BaseAllele Name tm291
CGC Name spn-4
Sequence ZC404.8
Phenotypelethal or sterile Dr. Y. Kohara: Development 130; 2495-2503 (2003).
Mutation site12753/12754-6G?-14068/14069 (1315 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(12940..13061, 13115..13830, 13879..13941, 13988..14092, 14140..14189))
Map position-2.15
BalancereT1
Map position of balancer
Sequence of primersIntRev:ACAGCAGCAGCTCTTCCGTC,ExtRev:CCCGAGGAGAGGTACTGCAA,IntFwd:TGACACGCCGGGATAATGAT,ExtFwd:TTCCCGCAGTCTCTCACGAC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Ogura K, Kishimoto N, Mitani S, Gengyo-Ando K, Kohara Y.
Translational control of maternal glp-1 mRNA by POS-1 and its interacting protein SPN-4 in Caenorhabditis elegans.
Development 2003 130(11) 2495-503 
[ PubMed ID = 12702662 ] [ RRC reference ]

Tsukamoto T, Gearhart MD, Spike CA, Huelgas-Morales G, Mews M, Boag PR, Beilharz TH, Greenstein D.
LIN-41 and OMA Ribonucleoprotein Complexes Mediate a Translational Repression-to-Activation Switch Controlling Oocyte Meiotic Maturation and the Oocyte-to-Embryo Transition in Caenorhabditis elegans.
Genetics 2017 206(4) 2007-2039 
[ PubMed ID = 28576864 ] [ RRC reference ]