Allele Name | tm290 |
Sequence Name | ZK783.1 |
CGC Name | fbn-1 |
Worm Base | Allele Name |
tm290
|
CGC Name |
fbn-1
|
Sequence |
ZK783.1
|
Phenotype | lethal or sterile. Dr. K. Nishiwaki: normal DTC migration. Dr. A. Frand: Mlt. |
Mutation site | 3846/3847-4450/4451 (604 bp deletion) |
Chromosome | III |
Putative gene structure | join(137..176, 386..488, 970..1076, 1127..1464, 1760..2078, 2263..2496, 2546..3160, 3279..3335, 3467..5178, 5228..5321, 5397..6003, 6064..6185, 6383..7312, 7365..7778, 7828..8592, 8992..10416, 10489..10647, 10777..11430, 11530..11670, 11974..12401, 12450..12735, 12788..13084, 13153..13343, 13394..13450, 13502..13858, 13981..14038, 14476..14489) |
Map position | -0.63 |
Balancer | hT2 |
Map position of balancer | |
Sequence of primers | ExtFwd:CGGAGCAGACTTCACAACAA,IntFwd:TCCGGATCGATTCAAACTTC,ExtRev:ACGGTAGCTGGCTCAACAGT,IntRev:TGATTCTCCAGATCCTTCCG |
Distributed lab | |
Depositor | Dr. S. Mitani |
References |
Please submit your publication
Cohen JD, Sparacio AP, Belfi AC, Forman-Rubinsky R, Hall DH, Maul-Newby H, Frand AR, Sundaram MV. A multi-layered and dynamic apical extracellular matrix shapes the vulva lumen in Caenorhabditis elegans. Elife 2020 9
[ PubMed ID = 32975517 ]
[ RRC reference ]
|
Lažetić V, Joseph BB, Bernazzani SM, Fay DS. Actin organization and endocytic trafficking are controlled by a network linking NIMA-related kinases to the CDC-42-SID-3/ACK1 pathway. PLoS Genet 2018 14(4) e1007313
[ PubMed ID = 29608564 ]
[ RRC reference ]
|
Vuong-Brender TTK, Suman SK, Labouesse M. The apical ECM preserves embryonic integrity and distributes mechanical stress during morphogenesis. Development 2017 144(23) 4336-4349
[ PubMed ID = 28526752 ]
[ RRC reference ]
|
Yochem J, Lažetić V, Bell L, Chen L, Fay D. C. elegans NIMA-related kinases NEKL-2 and NEKL-3 are required for the completion of molting. Dev Biol 2015 398(2) 255-66
[ PubMed ID = 25523392 ]
[ RRC reference ]
|
Kelley M, Yochem J, Krieg M, Calixto A, Heiman MG, Kuzmanov A, Meli V, Chalfie M, Goodman MB, Shaham S, Frand A, Fay DS. FBN-1, a fibrillin-related protein, is required for resistance of the epidermis to mechanical deformation during C. elegans embryogenesis. Elife 2015 4
[ PubMed ID = 25798732 ]
[ RRC reference ]
|
|