Mutants (Isolated)

tm290

Allele Nametm290
Sequence NameZK783.1
CGC Namefbn-1
Worm BaseAllele Name tm290
CGC Name fbn-1
Sequence ZK783.1
Phenotypelethal or sterile. Dr. K. Nishiwaki: normal DTC migration. Dr. A. Frand: Mlt.
Mutation site3846/3847-4450/4451 (604 bp deletion)
ChromosomeIII
Putative gene structurejoin(137..176, 386..488, 970..1076, 1127..1464, 1760..2078, 2263..2496, 2546..3160, 3279..3335, 3467..5178, 5228..5321, 5397..6003, 6064..6185, 6383..7312, 7365..7778, 7828..8592, 8992..10416, 10489..10647, 10777..11430, 11530..11670, 11974..12401, 12450..12735, 12788..13084, 13153..13343, 13394..13450, 13502..13858, 13981..14038, 14476..14489)
Map position-0.63
BalancerhT2
Map position of balancer
Sequence of primersExtFwd:CGGAGCAGACTTCACAACAA,IntFwd:TCCGGATCGATTCAAACTTC,ExtRev:ACGGTAGCTGGCTCAACAGT,IntRev:TGATTCTCCAGATCCTTCCG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Vuong-Brender TTK, Suman SK, Labouesse M.
The apical ECM preserves embryonic integrity and distributes mechanical stress during morphogenesis.
Development 2017 144(23) 4336-4349 
[ PubMed ID = 28526752 ] [ RRC reference ]

Yochem J, Lažetić V, Bell L, Chen L, Fay D.
C. elegans NIMA-related kinases NEKL-2 and NEKL-3 are required for the completion of molting.
Dev. Biol. 2015 398(2) 255-66 
[ PubMed ID = 25523392 ] [ RRC reference ]

Lažetić V, Joseph BB, Bernazzani SM, Fay DS.
Actin organization and endocytic trafficking are controlled by a network linking NIMA-related kinases to the CDC-42-SID-3/ACK1 pathway.
PLoS Genet. 2018 14(4) e1007313 
[ PubMed ID = 29608564 ] [ RRC reference ]

Kelley M, Yochem J, Krieg M, Calixto A, Heiman MG, Kuzmanov A, Meli V, Chalfie M, Goodman MB, Shaham S, Frand A, Fay DS.
FBN-1, a fibrillin-related protein, is required for resistance of the epidermis to mechanical deformation during C. elegans embryogenesis.
Elife 2015 4  
[ PubMed ID = 25798732 ] [ RRC reference ]