Home > Mutants (Isolated) > tm2893

Mutants (Isolated)

Allele Name		tm2893
Allele Type		Normal
Sequence Name		K08E3.8
Gene Name		mdt-29
Worm Base	Allele Name	tm2893
	Gene Name	mdt-29
	Sequence	K08E3.8
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		34016/34017-34254/34255 (238 bp deletion)
Chromosome		III
Putative gene structure		join(32753..32800, 33239..33346, 33842..34051, 34400..34630, 36662..37009, 37453..37713, 37823..37942)
Map position		21.56
Balancer
Map position of balancer
Sequence of primers		IntFwd:ATGGTACCACAAGGAGGCTC,IntRev:CCAGGTCTTTGAATGCTTCC,ExtFwd:GCCATACCAACGAGCTCGAA,ExtRev:CCGATCCAGGTCTTTGAATG
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Steimel A, Suh J, Hussainkhel A, Deheshi S, Grants JM, Zapf R, Moerman DG, Taubert S, Hutter H. The C. elegans CDK8 Mediator module regulates axon guidance decisions in the ventral nerve cord and during dorsal axon navigation. Dev Biol 2013 377(2) 385-98  [ PubMed ID = 23458898 ] [ RRC reference ] Xia D, Huang X, Zhang H. The temporally regulated transcription factor sel-7 controls developmental timing in C. elegans. Dev Biol 2009 332(2) 246-57  [ PubMed ID = 19500563 ] [ RRC reference ]