Mutants (Isolated)

tm289

Allele Nametm289
Sequence NameF22D3.6 + F22D3.1
CGC Namemalt-1 + ceh-38
Worm BaseAllele Name tm289
CGC Name malt-1 + ceh-38
Sequence F22D3.6 + F22D3.1
Phenotypelethal or sterile. Dr. Y-C. Wu: Let caused metabolic defects.
Mutation site25882/25883-AAAAAATTTTATG-26855/26856 (973 bp deletion)
ChromosomeII
Putative gene structureF22D3.6 = complement(join(22981..23313, 23359..23447, 23739..23888, 23962..24058, 24106..24220, 24428..24501, 24550..24662, 24711..24810, 25106..25329, 25379..25539, 25582..25750, 25911..26001, 26049..26130, 26184..26305)); F22D3.1 = join(26644..26708, 27008..27111, 27157..27468, 27526..27619, 27748..28063, 28213..28672, 28793..29033, 29167..29253, 29383..30412, 26644..26708, 27008..27111, 27157..27468, 27526..27619, 27748..28063, 28186..28672, 28793..29033, 29167..29253, 29383..30412)
Map position0.15
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersExtFwd:TCCGAATATGGTGAGCCTTC,IntFwd:TTGATGTTCATTCGAGCATTT,ExtRev:TTGCTAATGGCTGTGCAACC,IntRev:TTCGACGGAATGTCTCACGT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Staal J, Driege Y, Haegman M, Borghi A, Hulpiau P, Lievens L, Gul IS, Sundararaman S, Gonçalves A, Dhondt I, Pinzón JH, Braeckman BP, Technau U, Saeys Y, van Roy F, Beyaert R.
Ancient Origin of the CARD-Coiled Coil/Bcl10/MALT1-Like Paracaspase Signaling Complex Indicates Unknown Critical Functions.
Front Immunol 2018 9 1136 
[ PubMed ID = 29881386 ] [ RRC reference ]