Mutants (Isolated)

tm2886

Allele Nametm2886
Sequence NameR06F6.5
CGC Namenpp-19
Worm BaseAllele Name tm2886
CGC Name npp-19
Sequence R06F6.5
Phenotypehomozygous viable.
Mutation site12165/12166-12425/12426 (260 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(11656..11727, 11780..11846, 12026..12210, 12261..12652, 12703..12975, 13025..13098, 13165..13238))
Map position2.98
Balancer
Map position of balancer
Sequence of primersExtFwd:TGATCGGCCATATCGTTCTC,IntFwd:CATGGAAGCAGATCGGTTTG,ExtRev:CAGGCCATGTTCTCGCATCT,IntRev:CATCCGGAAGGCATAACTCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
RĂ³denas E, Klerkx EP, Ayuso C, Audhya A, Askjaer P.
Early embryonic requirement for nucleoporin Nup35/NPP-19 in nuclear assembly.
Dev. Biol. 2009 327(2) 399-409 
[ PubMed ID = 19146848 ] [ RRC reference ]

Askjaer P, Galy V, Meister P.
Modern tools to study nuclear pore complexes and nucleocytoplasmic transport in Caenorhabditis elegans.
Methods Cell Biol. 2014 122 277-310 
[ PubMed ID = 24857735 ] [ RRC reference ]