Mutants (Isolated)

tm2877

Allele Nametm2877
Sequence NameC43H6.9
CGC Nameglr-7
Worm BaseAllele Name tm2877
CGC Name glr-7
Sequence C43H6.9
Phenotypehomozygous viable. Dr. K. Ashrafi: wild-type Nile Red staining. Dr. I. Mori: normal thermotaxix at 20C.
Mutation site19770/19771-CTCTCTGATGCGCTTCCTT-20253/20254 (483 bp deletion + 19 bp insertion)
ChromosomeX
Putative gene structurecomplement(join(19514..19745, 19798..19930, 19977..20167, 20215..20325, 20383..20521, 21268..21347, 21395..21843, 21892..21954))
Map position-15.56
Balancer
Map position of balancer
Sequence of primersIntRev:TTCCGGCCGTTTGGTTGCTG,ExtRev:GGGAGTAAGCTATAGCACTG,IntFwd:TCATCCGATGAGTCAGGGCA,ExtFwd:AACACAGCCTGAGCCCAGTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Cunningham KA, Hua Z, Srinivasan S, Liu J, Lee BH, Edwards RH, Ashrafi K.
AMP-activated kinase links serotonergic signaling to glutamate release for regulation of feeding behavior in C. elegans.
Cell Metab. 2012 16(1) 113-21 
[ PubMed ID = 22768843 ] [ RRC reference ]

Li Z, Li Y, Yi Y, Huang W, Yang S, Niu W, Zhang L, Xu Z, Qu A, Wu Z, Xu T.
Dissecting a central flip-flop circuit that integrates contradictory sensory cues in C. elegans feeding regulation.
Nat Commun 2012 3 776 
[ PubMed ID = 22491324 ] [ RRC reference ]

Bhatla N, Droste R, Sando SR, Huang A, Horvitz HR.
Distinct Neural Circuits Control Rhythm Inhibition and Spitting by the Myogenic Pharynx of C. elegans.
Curr. Biol. 2015 25(16) 2075-89 
[ PubMed ID = 26212880 ] [ RRC reference ]

Hardaway JA, Sturgeon SM, Snarrenberg CL, Li Z, Xu XZ, Bermingham DP, Odiase P, Spencer WC, Miller DM 3rd, Carvelli L, Hardie SL, Blakely RD.
Glial Expression of the Caenorhabditis elegans Gene swip-10 Supports Glutamate Dependent Control of Extrasynaptic Dopamine Signaling.
J. Neurosci. 2015 35(25) 9409-23 
[ PubMed ID = 26109664 ] [ RRC reference ]