Mutants (Isolated)

tm2872

Allele Nametm2872
Sequence NameY74C9A.5
CGC NameY74C9A.5
Worm BaseAllele Name tm2872
CGC Name Y74C9A.5
Sequence Y74C9A.5
Phenotypehomozygous viable
Mutation site29789/29790-30154/30155 (365 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(28220..28345, 28856..28966, 29040..29307, 29709..30364, 31709..32012, 32352..32482, 32539..32705, 34635..34845))
Map position-20.46
Balancer
Map position of balancer
Sequence of primersExtFwd:GTGTCGATTTACGGGTTCGT,IntFwd:GTAAATCGACACGAGCGATC,ExtRev:TGCCATATGCTCTCTCGTTG,IntRev:GCCAAGAGAACGAACGTATA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Yang YL, Loh KS, Liou BY, Chu IH, Kuo CJ, Chen HD, Chen CS.
SESN-1 is a positive regulator of lifespan in Caenorhabditis elegans.
Exp. Gerontol. 2013 48(3) 371-9 
[ PubMed ID = 23318476 ] [ RRC reference ]