Mutants (Isolated)

tm2869

Allele Nametm2869
Allele TypeNormal
Sequence NameY20F4.2
Gene Namecrtc-1
Worm BaseAllele Name tm2869
Gene Name crtc-1
Sequence Y20F4.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. T. Katada: shows survival rate similar to N2 during L1 diapause.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 31153/31154-31461/31462 (308 bp deletion)
ChromosomeI
Putative gene structurejoin(25635..25736, 27047..27124, 27428..27559, 27611..27816, 28896..29195, 30872..31349, 32497..32622)
Map position-12
Balancer
Map position of balancer
Sequence of primersExtFwd:GTCGTGTACTCCACAATGAC,IntFwd:AGATATGGCCTGGCCTAGTC,ExtRev:GGGCCACGTGGTGTCAGAAT,IntRev:GTGAGGGGCTGTTCCATTAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Feldmann KG, Chowdhury A, Becker JL, McAlpin N, Ahmed T, Haider S, Richard Xia JX, Diaz K, Mehta MG, Mano I.
Non-canonical activation of CREB mediates neuroprotection in a Caenorhabditis elegans model of excitotoxic necrosis.
J Neurochem 2019 148(4) 531-549 
[ PubMed ID = 30447010 ] [ RRC reference ]

Chen YC, Chen HJ, Tseng WC, Hsu JM, Huang TT, Chen CH, Pan CL.
A C. elegans Thermosensory Circuit Regulates Longevity through crh-1/CREB-Dependent flp-6 Neuropeptide Signaling.
Dev Cell 2016 39(2) 209-223 
[ PubMed ID = 27720609 ] [ RRC reference ]

Li W, Bell HW, Ahnn J, Lee SK.
Regulator of Calcineurin (RCAN-1) Regulates Thermotaxis Behavior in Caenorhabditis elegans.
J Mol Biol 2015 427(22) 3457-3468 
[ PubMed ID = 26232604 ] [ RRC reference ]