Home > Mutants (Isolated) > tm2869

Mutants (Isolated)

Allele Name		tm2869
Allele Type		Normal
Sequence Name		Y20F4.2
Gene Name		crtc-1
Worm Base	Allele Name	tm2869
	Gene Name	crtc-1
	Sequence	Y20F4.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. T. Katada: shows survival rate similar to N2 during L1 diapause.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		31153/31154-31461/31462 (308 bp deletion)
Chromosome		I
Putative gene structure		join(25635..25736, 27047..27124, 27428..27559, 27611..27816, 28896..29195, 30872..31349, 32497..32622)
Map position		-12
Balancer
Map position of balancer
Sequence of primers		ExtFwd:GTCGTGTACTCCACAATGAC,IntFwd:AGATATGGCCTGGCCTAGTC,ExtRev:GGGCCACGTGGTGTCAGAAT,IntRev:GTGAGGGGCTGTTCCATTAC
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Feldmann KG, Chowdhury A, Becker JL, McAlpin N, Ahmed T, Haider S, Richard Xia JX, Diaz K, Mehta MG, Mano I. Non-canonical activation of CREB mediates neuroprotection in a Caenorhabditis elegans model of excitotoxic necrosis. J Neurochem 2019 148(4) 531-549  [ PubMed ID = 30447010 ] [ RRC reference ] Chen YC, Chen HJ, Tseng WC, Hsu JM, Huang TT, Chen CH, Pan CL. A C. elegans Thermosensory Circuit Regulates Longevity through crh-1/CREB-Dependent flp-6 Neuropeptide Signaling. Dev Cell 2016 39(2) 209-223  [ PubMed ID = 27720609 ] [ RRC reference ] Li W, Bell HW, Ahnn J, Lee SK. Regulator of Calcineurin (RCAN-1) Regulates Thermotaxis Behavior in Caenorhabditis elegans. J Mol Biol 2015 427(22) 3457-3468  [ PubMed ID = 26232604 ] [ RRC reference ]