Mutants (Isolated)

tm2868

Allele Nametm2868
Sequence NameC27A2.1
CGC Namesmc-5
Worm BaseAllele Name tm2868
CGC Name smc-5
Sequence C27A2.1
Phenotypehomozygous viable.
Mutation site10345/10346-10790/10791 (445 bp deletion)
ChromosomeII
Putative gene structurejoin(9407..9498, 9547..9741, 9797..9929, 9974..10438, 10485..10812, 10861..11012, 11923..12315, 12365..12514, 12563..12838, 13101..13379, 13426..14133, 14181..14240)
Map position-2.55
Balancer
Map position of balancer
Sequence of primersIntFwd:GCTCATTACCAGATCGCACT,ExtFwd:TTATCGCCTAGAGCTCAGCT,ExtRev:GGGCATATATACGTCTCCTT,IntRev:GTTGATACCAGCGATAGGCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Hong Y, Sonneville R, Agostinho A, Meier B, Wang B, Blow JJ, Gartner A.
The SMC-5/6 Complex and the HIM-6 (BLM) Helicase Synergistically Promote Meiotic Recombination Intermediate Processing and Chromosome Maturation during Caenorhabditis elegans Meiosis.
PLoS Genet. 2016 12(3) e1005872 
[ PubMed ID = 27010650 ] [ RRC reference ]

Bickel JS, Chen L, Hayward J, Yeap SL, Alkers AE, Chan RC.
Structural maintenance of chromosomes (SMC) proteins promote homolog-independent recombination repair in meiosis crucial for germ cell genomic stability.
PLoS Genet. 2010 6(7) e1001028 
[ PubMed ID = 20661436 ] [ RRC reference ]