Mutants (Isolated)

tm2866

Allele Nametm2866
Sequence NameT20G5.1
CGC Namechc-1
Worm BaseAllele Name tm2866
CGC Name chc-1
Sequence T20G5.1
Phenotypelethal or sterile. Dr. O. Blacque: Let, could not examine cilia. Dr. Z. Zhou: Emb, homozygous embryos from heterozygous mothers do not show any Ced phenotype.
Mutation site35909/35910-36756/36757 (847 bp deletion)
ChromosomeIII
Putative gene structurejoin(32477..32599, 32647..32767, 32819..33183, 33230..33409, 33518..34378, 34423..34725, 34773..35927, 35974..37195, 37248..37826, 37875..38011)
Map position2.01
BalancerhT2 [qIs48]
Map position of balancer
Sequence of primersIntRev:GGATGCTGCATCATTGTCAG,IntFwd:TTCAAGCTGCCACGCGCACA,ExtRev:GGTAGAACTGCATTGCTTTG,ExtFwd:CAGCCAGGACCCAGAAGTTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Zhang H, Kim A, Abraham N, Khan LA, Hall DH, Fleming JT, Gobel V.
Clathrin and AP-1 regulate apical polarity and lumen formation during C. elegans tubulogenesis.
Development 2012 139(11) 2071-83 
[ PubMed ID = 22535410 ] [ RRC reference ]