Mutants (Isolated)

tm2862

Allele Nametm2862
Sequence NameY56A3A.29
CGC Nameung-1
Worm BaseAllele Name tm2862
CGC Name ung-1
Sequence Y56A3A.29
Phenotypehomozygous viable
Mutation site139479/139480-139772/139773 (293 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(137824..137940, 139514..140186, 140232..140290))
Map position13.61
Balancer
Map position of balancer
Sequence of primersExtFwd:ATCGACACAACACGGTGCGT,IntFwd:GACACAACACGGTGCGTTCC,IntRev:GTTCCTCAAAGCATCCGCTG,ExtRev:GACTGTAAGAATTCCGGACA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Nakamura N, Morinaga H, Kikuchi M, Yonekura S, Ishii N, Yamamoto K, Yonei S, Zhang QM.
Cloning and characterization of uracil-DNA glycosylase and the biological consequences of the loss of its function in the nematode Caenorhabditis elegans.
Mutagenesis 2008 23(5) 407-13 
[ PubMed ID = 18524757 ] [ RRC reference ]

Skjeldam HK, Kassahun H, Fensgård O, SenGupta T, Babaie E, Lindvall JM, Arczewska K, Nilsen H.
Loss of Caenorhabditis elegans UNG-1 uracil-DNA glycosylase affects apoptosis in response to DNA damaging agents.
DNA Repair (Amst.) 2010 9(8) 861-70 
[ PubMed ID = 20493785 ] [ RRC reference ]

Kato Y, Moriwaki T, Funakoshi M, Zhang-Akiyama QM.
Caenorhabditis elegans EXO-3 contributes to longevity and reproduction: differential roles in somatic cells and germ cells.
Mutat. Res. 2015 772 46-54 
[ PubMed ID = 25772110 ] [ RRC reference ]