Mutants (Isolated)

tm2859

Allele Nametm2859
Sequence NameF38A5.13
CGC Namednj-11
Worm BaseAllele Name tm2859
CGC Name dnj-11
Sequence F38A5.13
Phenotypehomozygous viable.
Mutation site6292/6293-6933/6934 (641 bp deletion)
ChromosomeIV
Putative gene structurejoin(5892..5975, 6028..6304, 6350..6885, 6940..7077, 7134..7496, 7547..7918)
Map position3.21
Balancer
Map position of balancer
Sequence of primersIntRev:TGAAACGACGAATGCAGGCT,ExtRev:GACGCACCGTTCATCTAATG,IntFwd:GCCACTGTACGCTTCCAATC,ExtFwd:AACTCACACTGGGCCACTGT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Hatzold J, Conradt B.
Control of apoptosis by asymmetric cell division.
PLoS Biol. 2008 6(4) e84 
[ PubMed ID = 18399720 ] [ RRC reference ]

Yan B, Memar N, Gallinger J, Conradt B.
Coordination of cell proliferation and cell fate determination by CES-1 snail.
PLoS Genet. 2013 9(10) e1003884 
[ PubMed ID = 24204299 ] [ RRC reference ]