Mutants (Isolated)

tm2842

Allele Nametm2842
Sequence NameC47D12.8
CGC NameC47D12.8
Worm BaseAllele Name tm2842
CGC Name C47D12.8
Sequence C47D12.8
Phenotypehomozygous viable
Mutation site41906/41907-42249/42250 (343 bp deletion)
ChromosomeII
Putative gene structurejoin(41254..41693, 41749..42488, 43003..43379, AL033535.1:1522..1611, AL033535.1:1657..1782, AL033535.1:2423..2560, AL033535.1:2611..2760, AL033535.1:3507..3593, AL033535.1:3644..3748, AL033535.1:4489..4704, AL033535.1:5005..5220, AL033535.1:6083..6205)
Map position3.97
Balancer
Map position of balancer
Sequence of primersIntRev:GTACTGTCCATTTCGCAGGA,ExtRev:GAATCTCCGAGAGTACTGTC,ExtFwd:ATCGACGTCTCCTGGCCCTA,IntFwd:GGCCCTAGTTCTCAATACAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Gurkar AU, Robinson AR, Cui Y, Li X, Allani SK, Webster A, Muravia M, Fallahi M, Weissbach H, Robbins PD, Wang Y, Kelley EE, Croix CMS, Niedernhofer LJ, Gill MS.
Dysregulation of DAF-16/FOXO3A-mediated stress responses accelerates oxidative DNA damage induced aging.
Redox Biol 2018 18 191-199 
[ PubMed ID = 30031267 ] [ RRC reference ]

González-Huici V, Wang B, Gartner A.
A Role for the Nonsense-Mediated mRNA Decay Pathway in Maintaining Genome Stability in Caenorhabditis elegans.
Genetics 2017 206(4) 1853-1864 
[ PubMed ID = 28634159 ] [ RRC reference ]

Bertolini S, Wang B, Meier B, Hong Y, Gartner A.
Caenorhabditis elegans BUB-3 and SAN-1/MAD3 Spindle Assembly Checkpoint Components Are Required for Genome Stability in Response to Treatment with Ionizing Radiation.
G3 (Bethesda) 2017 7(12) 3875-3885 
[ PubMed ID = 29046436 ] [ RRC reference ]

Agostinho A, Meier B, Sonneville R, Jagut M, Woglar A, Blow J, Jantsch V, Gartner A.
Combinatorial regulation of meiotic holliday junction resolution in C. elegans by HIM-6 (BLM) helicase, SLX-4, and the SLX-1, MUS-81 and XPF-1 nucleases.
PLoS Genet. 2013 9(7) e1003591 
[ PubMed ID = 23901331 ] [ RRC reference ]

O'Neil NJ, Martin JS, Youds JL, Ward JD, Petalcorin MI, Rose AM, Boulton SJ.
Joint molecule resolution requires the redundant activities of MUS-81 and XPF-1 during Caenorhabditis elegans meiosis.
PLoS Genet. 2013 9(7) e1003582 
[ PubMed ID = 23874209 ] [ RRC reference ]

Lans H, Lindvall JM, Thijssen K, Karambelas AE, Cupac D, Fensgård O, Jansen G, Hoeijmakers JH, Nilsen H, Vermeulen W.
DNA damage leads to progressive replicative decline but extends the life span of long-lived mutant animals.
Cell Death Differ. 2013 20(12) 1709-18 
[ PubMed ID = 24013725 ] [ RRC reference ]

Wilson DM 3rd, Rieckher M, Williams AB, Schumacher B.
Systematic analysis of DNA crosslink repair pathways during development and aging in Caenorhabditis elegans.
Nucleic Acids Res. 2017 45(16) 9467-9480 
[ PubMed ID = 28934497 ] [ RRC reference ]

Lans H, Vermeulen W.
Nucleotide Excision Repair in Caenorhabditis elegans.
Mol Biol Int 2011 2011 542795 
[ PubMed ID = 22091407 ] [ RRC reference ]