Mutants (Isolated)

tm2841

Allele Nametm2841
Sequence NameC06G3.2
CGC Nameklp-18
Worm BaseAllele Name tm2841
CGC Name klp-18
Sequence C06G3.2
Phenotypelethal or sterile. Dr. H. Sawa: not Psa., Dr. I. Mori: maternal effect embryonic lethal, weakly thermotaxis abnormal when raised at 20˚C, but normal thermotaxis when raised at 17˚C and 23˚C.
Mutation site28622/28623-29106/29107 (484 bp deletion)
ChromosomeIV
Putative gene structurejoin(28272..28522, 28569..29658, 29706..30070, 30122..30309, 30359..30693, 30743..31162, 31208..31357)
Map position3.28
BalancernT1 [qIs51]
Map position of balancer
Sequence of primersExtFwd:TGGGACCGTGTTCGCCTATG,IntRev:TGACGTTGCCTCTTCGTGCT,IntFwd:ACAGGGTAAGTGCTTCCAAT,ExtRev:CCCTGAAGCAATCGTTCCGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Mullen TJ, Wignall SM.
Interplay between microtubule bundling and sorting factors ensures acentriolar spindle stability during C. elegans oocyte meiosis.
PLoS Genet. 2017 13(9) e1006986 
[ PubMed ID = 28910277 ] [ RRC reference ]

Wolff ID, Tran MV, Mullen TJ, Villeneuve AM, Wignall SM.
Assembly of Caenorhabditis elegans acentrosomal spindles occurs without evident microtubule-organizing centers and requires microtubule sorting by KLP-18/kinesin-12 and MESP-1.
Mol. Biol. Cell 2016 27(20) 3122-3131 
[ PubMed ID = 27559133 ] [ RRC reference ]