Mutants (Isolated)

tm2839

Allele Nametm2839
Sequence NameM01E11.5
CGC Namecey-3
Worm BaseAllele Name tm2839
CGC Name cey-3
Sequence M01E11.5
Phenotypehomozygous viable
Mutation site3937/3938-4161/4162 (224 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(3782..4151, 4198..4508, 4627..4743))
Map position0.2
Balancer
Map position of balancer
Sequence of primersExtRev:TACGGCGAAAATGTCGGACA,IntFwd:GTCGAGAGCAGAATCGCAAC,IntRev:GCGAATACTGCTGTCGAAGT,ExtFwd:TGCAGGAAACGGGGATCTAG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Arnold A, Rahman MM, Lee MC, Muehlhaeusser S, Katic I, Gaidatzis D, Hess D, Scheckel C, Wright JE, Stetak A, Boag PR, Ciosk R.
Functional characterization of C. elegans Y-box-binding proteins reveals tissue-specific functions and a critical role in the formation of polysomes.
Nucleic Acids Res. 2014 42(21) 13353-69 
[ PubMed ID = 25378320 ] [ RRC reference ]

Jablonski AM, Lamitina T, Liachko NF, Sabatella M, Lu J, Zhang L, Ostrow LW, Gupta P, Wu CY, Doshi S, Mojsilovic-Petrovic J, Lans H, Wang J, Kraemer B, Kalb RG.
Loss of RAD-23 Protects Against Models of Motor Neuron Disease by Enhancing Mutant Protein Clearance.
J. Neurosci. 2015 35(42) 14286-306 
[ PubMed ID = 26490867 ] [ RRC reference ]