Mutants (Isolated)

tm2831

Allele Nametm2831
Sequence NameY56A3A.34
CGC Namemir-86
Worm BaseAllele Name tm2831
CGC Name mir-86
Sequence Y56A3A.34
Phenotypehomozygous viable
Mutation site102667/102668-A-102938/102939 (271 bp deletion + 1 bp insertion)
ChromosomeIII
Putative gene structurecomplement(102898..102920)
Map position13.53
Balancer
Map position of balancer
Sequence of primersIntRev:ATTATCACTCGAGGCCGGTG,IntFwd:TGTCCCATGCCGATTCGATG,ExtRev:TCGAGCTTCTCACATACGTA,ExtFwd:GCTGGTGTCCCATGCCGATT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Jones MR, Rose AM, Baillie DL.
The ortholog of the human proto-oncogene ROS1 is required for epithelial development in C. elegans.
Genesis 2013 51(8) 545-61 
[ PubMed ID = 23733356 ] [ RRC reference ]