Mutants (Isolated)

tm2830

Allele Nametm2830
Sequence NameK07H8.3
CGC NameK07H8.3
Worm BaseAllele Name tm2830
CGC Name K07H8.3
Sequence K07H8.3
Phenotypelethal or sterile
Mutation site30837/30838-ATAATATCTCTATTTTTTATAAT-31240/31241 (403 bp deletion + 23 bp insertion)
ChromosomeIV
Putative gene structurejoin(30904..31050, 31103..31362, 31786..31927)
Map position3.69
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersExtFwd:GTGTATTGCCCCTCGGCGAA,ExtRev:ACGTTGGAAATCGAACGGGT,IntFwd:CCCTCGGCGAATTCGAGTTA,IntRev:GGGTGATTGGGAAACGTCGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Luo J, Shah S, Riabowol K, Mains PE.
The Caenorhabditis elegans ing-3 gene regulates ionizing radiation-induced germ-cell apoptosis in a p53-associated pathway.
Genetics 2009 181(2) 473-82 
[ PubMed ID = 19015549 ] [ RRC reference ]