Mutants (Isolated)

tm2823

Allele Nametm2823
Sequence NameB0025.2
CGC Namecsn-2
Worm BaseAllele Name tm2823
CGC Name csn-2
Sequence B0025.2
Phenotypelethal or sterile
Mutation site4300/4301-4700/4701 (400 bp deletion)
ChromosomeI
Putative gene structurejoin(3333..3374, 3635..3890, 4255..4671, 5867..6152, 6449..6749, 7221..7406)
Map position0.67
BalancerhT2
Map position of balancer
Sequence of primersExtFwd:AGACCCAGGAAAAGTTCGGT,IntFwd:GATAGTGGCTCAGAACCAGA,ExtRev:TATCATGGCGTGTGTGGCGA,IntRev:GCCGCAATGATGGTTATGGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Brockway H, Balukoff N, Dean M, Alleva B, Smolikove S.
The CSN/COP9 signalosome regulates synaptonemal complex assembly during meiotic prophase I of Caenorhabditis elegans.
PLoS Genet. 2014 10(11) e1004757 
[ PubMed ID = 25375142 ] [ RRC reference ]