Mutants (Isolated)

tm2812

Allele Nametm2812
Sequence NameF10G7.3
CGC Nameasf-1
Worm BaseAllele Name tm2812
CGC Name asf-1
Sequence F10G7.3
Phenotypehomozygous viable, Dr. F.P. Finger: Dev. Biol.329, 64 (2009)
Mutation site17928/17929-18134/18135 (206 bp deletion)
ChromosomeII
Putative gene structurejoin(17785..17845, 17895..18361, 18410..18560, 18630..18727)
Map position-3.48
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersExtRev:TCGGCCCCGTCAAGTGCATT,IntRev:AGCGTTGGCCTCCATCTCGT,ExtFwd:ATGGCTTCCCGTGTCAACAT,IntFwd:GAGCACTTGCCGCATGGTAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Grigsby IF, Finger FP.
UNC-85, a C. elegans homolog of the histone chaperone Asf1, functions in post-embryonic neuroblast replication.
Dev Biol 2008 319(1) 100-9 
[ PubMed ID = 18490010 ] [ RRC reference ]

Grigsby IF, Rutledge EM, Morton CA, Finger FP.
Functional redundancy of two C. elegans homologs of the histone chaperone Asf1 in germline DNA replication.
Dev Biol 2009 329(1) 64-79 
[ PubMed ID = 19233156 ] [ RRC reference ]