Mutants (Isolated)

tm2805

Allele Nametm2805
Sequence NameR01E6.3
CGC Namecah-4
Worm BaseAllele Name tm2805
CGC Name cah-4
Sequence R01E6.3
Phenotypelethal or sterile
Mutation site11693/11694-11972/11973 (279 bp deletion)
ChromosomeX
Putative gene structurejoin(10970..11108, 11165..11235, 11321..11420, 11472..11686, 11940..12167, 12215..12304)
Map position12.71
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersIntFwd:CCCAATTGACATCGTCCCAC,ExtRev:ATGGTGGGGTGGTAAGGGAT,IntRev:GTAAGGGATCCGAGGTATGT,ExtFwd:GTCCGCTAGGTTAAGCAAGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Sherman TA, Rongali SC, Matthews TA, Pfeiffer J, Nehrke K.
Identification of a nuclear carbonic anhydrase in Caenorhabditis elegans.
Biochim. Biophys. Acta 2012 1823(4) 808-17 
[ PubMed ID = 22245567 ] [ RRC reference ]

Giacomotto J, Pertl C, Borrel C, Walter MC, Bulst S, Johnsen B, Baillie DL, Lochm├╝ller H, Thirion C, S├ęgalat L.
Evaluation of the therapeutic potential of carbonic anhydrase inhibitors in two animal models of dystrophin deficient muscular dystrophy.
Hum. Mol. Genet. 2009 18(21) 4089-101 
[ PubMed ID = 19648295 ] [ RRC reference ]