Mutants (Isolated)

tm2803

Allele Nametm2803
Sequence NameZK1010.3
CGC NameZK1010.3
Worm BaseAllele Name tm2803
CGC Name ZK1010.3
Sequence ZK1010.3
Phenotypehomozygous viable
Mutation site3585/3586-3827/3828 (242 bp deletion)
ChromosomeIII
Putative gene structurejoin(3163..3230, 3290..3800, 3855..4100)
Map position20.68
Balancer
Map position of balancer
Sequence of primersIntRev:GCTGATACATCTTCACGTAG,IntFwd:GGCGCTGACTACAGTGCTGT,ExtRev:GTCAATCGCAATATGTCGGT,ExtFwd:AAATGCCAGGCGCTGACTAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Loveless T, Qadota H, Benian GM, Hardin J.
Caenorhabditis elegans SORB-1 localizes to integrin adhesion sites and is required for organization of sarcomeres and mitochondria in myocytes.
Mol Biol Cell 2017 28(25) 3621-3633 
[ PubMed ID = 28978740 ] [ RRC reference ]