Mutants (Isolated)

tm2802

Allele Nametm2802
Sequence NameF36A2.1
CGC Namecids-2
Worm BaseAllele Name tm2802
CGC Name cids-2
Sequence F36A2.1
Phenotypehomozygous viable. Dr. T. Blumenthal: Brood size normal and no embryo lethality. ~4% male at 25 C. Dr. T. Blumentahal: PNAS 105, 16665 (2008).
Mutation site6242/6243-6631/6632 (389 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(4175..4247, 4499..4628, 4676..4819, 4873..5088, 5135..5242, 5283..5427, 5487..5627, 5673..5785, 5840..6083, 6135..6281, 6333..6412, 6464..6567, 6618..6750, 6801..6915, 6974..7018))
Map position3.16
Balancer
Map position of balancer
Sequence of primersIntFwd:GGTATCCTGTGATAGGTGGT,ExtFwd:CCCGTATTTGCTCGTACTGA,IntRev:CAGGATGTGAGTTTGCGTTA,ExtRev:TGTGCTCACGTCGGACGTTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Chen F, Zhou Y, Qi YB, Khivansara V, Li H, Chun SY, Kim JK, Fu XD, Jin Y.
Context-dependent modulation of Pol II CTD phosphatase SSUP-72 regulates alternative polyadenylation in neuronal development.
Genes Dev 2015 29(22) 2377-90 
[ PubMed ID = 26588990 ] [ RRC reference ]

Cui M, Allen MA, Larsen A, Macmorris M, Han M, Blumenthal T.
Genes involved in pre-mRNA 3'-end formation and transcription termination revealed by a lin-15 operon Muv suppressor screen.
Proc Natl Acad Sci U S A 2008 105(43) 16665-70 
[ PubMed ID = 18946043 ] [ RRC reference ]