Allele Name | tm2802 |
Sequence Name | F36A2.1 |
CGC Name | cids-2 |
Worm Base | Allele Name |
tm2802
|
CGC Name |
cids-2
|
Sequence |
F36A2.1
|
Phenotype | homozygous viable. Dr. T. Blumenthal: Brood size normal and no embryo lethality. ~4% male at 25 C. Dr. T. Blumentahal: PNAS 105, 16665 (2008). |
Mutation site | 6242/6243-6631/6632 (389 bp deletion) |
Chromosome | I |
Putative gene structure | complement(join(4175..4247, 4499..4628, 4676..4819, 4873..5088, 5135..5242, 5283..5427, 5487..5627, 5673..5785, 5840..6083, 6135..6281, 6333..6412, 6464..6567, 6618..6750, 6801..6915, 6974..7018)) |
Map position | 3.16 |
Balancer | |
Map position of balancer | |
Sequence of primers | IntFwd:GGTATCCTGTGATAGGTGGT,ExtFwd:CCCGTATTTGCTCGTACTGA,IntRev:CAGGATGTGAGTTTGCGTTA,ExtRev:TGTGCTCACGTCGGACGTTG |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Chen F, Zhou Y, Qi YB, Khivansara V, Li H, Chun SY, Kim JK, Fu XD, Jin Y. Context-dependent modulation of Pol II CTD phosphatase SSUP-72 regulates alternative polyadenylation in neuronal development. Genes Dev 2015 29(22) 2377-90
[ PubMed ID = 26588990 ]
[ RRC reference ]
|
Cui M, Allen MA, Larsen A, Macmorris M, Han M, Blumenthal T. Genes involved in pre-mRNA 3'-end formation and transcription termination revealed by a lin-15 operon Muv suppressor screen. Proc Natl Acad Sci U S A 2008 105(43) 16665-70
[ PubMed ID = 18946043 ]
[ RRC reference ]
|
|