Mutants (Isolated)

tm2790

Allele Nametm2790
Sequence NameR06B10.5
CGC Nametbc-10
Worm BaseAllele Name tm2790
CGC Name tbc-10
Sequence R06B10.5
Phenotypehomozygous viable.
Mutation site19345/19346-19577/19578 (232 bp deletion)
ChromosomeIII
Putative gene structurejoin(17423..17578, 17625..17863, 18446..18662, 19294..19409, 19606..19861, 21414..21683, 22365..22448)
Map position-24.86
Balancer
Map position of balancer
Sequence of primersExtRev:CCCAACAGCTATCGGGTTAC,IntFwd:GCTAGGCTAATTTTGGCGTG,ExtFwd:GAGGGGTACTGTAAGCCCGA,IntRev:GGCCAATGTCGTAAGATCTG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Coakley S, Ritchie FK, Galbraith KM, Hilliard MA.
Epidermal control of axonal attachment via β-spectrin and the GTPase-activating protein TBC-10 prevents axonal degeneration.
Nat Commun 2020 11(1) 133 
[ PubMed ID = 31919407 ] [ RRC reference ]

Haley R, Wang Y, Zhou Z.
The small GTPase RAB-35 defines a third pathway that is required for the recognition and degradation of apoptotic cells.
PLoS Genet 2018 14(8) e1007558 
[ PubMed ID = 30138370 ] [ RRC reference ]