Mutants (Isolated)

tm2784

Allele Nametm2784
Allele TypeBalanced
Sequence NameF10G8.3
Gene Namenpp-17
Worm BaseAllele Name tm2784
Gene Name npp-17
Sequence F10G8.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile. Dr. H. Sawa: non Psa.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 9489/9490-9891/9892 (402 bp deletion)
ChromosomeI
Putative gene structurejoin(8261..8368, 8413..8505, 9369..10202, 11259..11345)
Map position4.55
BalancerhT2 [bli-4(e937) let-? qIs48]
Map position of balancer
Sequence of primersExtRev:CCTTTGCTCCGCAGAAGGTG,IntRev:CGCAGAAGGTGTACCACCTC,ExtFwd:CCAATTCTAGATATCGCCTG,IntFwd:TCGCCTGGATTGAAGACAGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

Baker ST, Grill B.
Defining Minimal Binding Regions in Regulator of Presynaptic Morphology 1 (RPM-1) Using Caenorhabditis elegans Neurons Reveals Differential Signaling Complexes.
J Biol Chem 2017 292(6) 2519-2530 
[ PubMed ID = 27979965 ] [ RRC reference ]

Grill B, Chen L, Tulgren ED, Baker ST, Bienvenut W, Anderson M, Quadroni M, Jin Y, Garner CC.
RAE-1, a novel PHR binding protein, is required for axon termination and synapse formation in Caenorhabditis elegans.
J Neurosci 2012 32(8) 2628-36 
[ PubMed ID = 22357847 ] [ RRC reference ]

Askjaer P, Galy V, Meister P.
Modern tools to study nuclear pore complexes and nucleocytoplasmic transport in Caenorhabditis elegans.
Methods Cell Biol 2014 122 277-310 
[ PubMed ID = 24857735 ] [ RRC reference ]