Mutants (Isolated)

tm2765

Allele Nametm2765
Sequence NameT07D10.2
CGC NameT07D10.2
Worm BaseAllele Name tm2765
CGC Name T07D10.2
Sequence T07D10.2
Phenotypehomozygous viable
Mutation site26729/26730-26938/26939 (209 bp deletion)
ChromosomeI
Putative gene structurejoin(26578..26688, 26733..26876, 26990..27545, 27595..27738, 28307..28491)
Map position13.73
Balancer
Map position of balancer
Sequence of primersExtFwd:TACGTGTTCAATCATGGGAG,IntFwd:TGTCATTCTGCTCACCCCAA,ExtRev:ACTTATCGCCGTTGGCCACA,IntRev:CGTTGGCCACACGGCATCAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Beets I, Janssen T, Meelkop E, Temmerman L, Suetens N, Rademakers S, Jansen G, Schoofs L.
Vasopressin/oxytocin-related signaling regulates gustatory associative learning in C. elegans.
Science 2012 338(6106) 543-5 
[ PubMed ID = 23112336 ] [ RRC reference ]

Scott E, Hudson A, Feist E, Calahorro F, Dillon J, de Freitas R, Wand M, Schoofs L, O'Connor V, Holden-Dye L.
An oxytocin-dependent social interaction between larvae and adult C. elegans.
Sci Rep 2017 7(1) 10122 
[ PubMed ID = 28860630 ] [ RRC reference ]

Garrison JL, Macosko EZ, Bernstein S, Pokala N, Albrecht DR, Bargmann CI.
Oxytocin/vasopressin-related peptides have an ancient role in reproductive behavior.
Science 2012 338(6106) 540-3 
[ PubMed ID = 23112335 ] [ RRC reference ]

Mills H, Wragg R, Hapiak V, Castelletto M, Zahratka J, Harris G, Summers P, Korchnak A, Law W, Bamber B, Komuniecki R.
Monoamines and neuropeptides interact to inhibit aversive behaviour in Caenorhabditis elegans.
EMBO J. 2012 31(3) 667-78 
[ PubMed ID = 22124329 ] [ RRC reference ]

Harris G, Mills H, Wragg R, Hapiak V, Castelletto M, Korchnak A, Komuniecki RW.
The monoaminergic modulation of sensory-mediated aversive responses in Caenorhabditis elegans requires glutamatergic/peptidergic cotransmission.
J. Neurosci. 2010 30(23) 7889-99 
[ PubMed ID = 20534837 ] [ RRC reference ]

Hapiak V, Summers P, Ortega A, Law WJ, Stein A, Komuniecki R.
Neuropeptides amplify and focus the monoaminergic inhibition of nociception in Caenorhabditis elegans.
J. Neurosci. 2013 33(35) 14107-16 
[ PubMed ID = 23986246 ] [ RRC reference ]