Mutants (Isolated)

tm2760

Allele Nametm2760
Sequence NameY53G8AR.3
CGC Nameral-1
Worm BaseAllele Name tm2760
CGC Name ral-1
Sequence Y53G8AR.3
Phenotypelethal or sterile
Mutation site31342/31343-31661/31662 (319 bp deletion)
ChromosomeIII
Putative gene structurejoin(31144..31200, 31276..31341, 32350..32471, 32777..32863, 34473..34650, 35947..36078)
Map position-7.29
BalancerqC1 [qIs26]
Map position of balancer
Sequence of primersIntFwd:TGCAGGTTATTATGGTCGGA,ExtRev:CCGAAACTCGTTTGTAGCCT,IntRev:CCCTCACCACTTCGATAGTA,ExtFwd:CGTACCCCTCAACTGTCGTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Zand TP, Reiner DJ, Der CJ.
Ras effector switching promotes divergent cell fates in C. elegans vulval patterning.
Dev Cell 2011 20(1) 84-96 
[ PubMed ID = 21238927 ] [ RRC reference ]

Shin H, Braendle C, Monahan KB, Kaplan REW, Zand TP, Mote FS, Peters EC, Reiner DJ.
Developmental fidelity is imposed by genetically separable RalGEF activities that mediate opposing signals.
PLoS Genet 2019 15(5) e1008056 
[ PubMed ID = 31086367 ] [ RRC reference ]

Reiner DJ, Lundquist EA.
Small GTPases.
WormBook 2018 2018 1-65 
[ PubMed ID = 27218782 ] [ RRC reference ]