Home > Mutants (Isolated) > tm2760

Mutants (Isolated)

Allele Name		tm2760
Allele Type		Balanced
Sequence Name		Y53G8AR.3
Gene Name		ral-1
Worm Base	Allele Name	tm2760
	Gene Name	ral-1
	Sequence	Y53G8AR.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		31342/31343-31661/31662 (319 bp deletion)
Chromosome		III
Putative gene structure		join(31144..31200, 31276..31341, 32350..32471, 32777..32863, 34473..34650, 35947..36078)
Map position		-7.29
Balancer		qC1 [e1259 q339 qIs26]
Map position of balancer
Sequence of primers		IntFwd:TGCAGGTTATTATGGTCGGA,ExtRev:CCGAAACTCGTTTGTAGCCT,IntRev:CCCTCACCACTTCGATAGTA,ExtFwd:CGTACCCCTCAACTGTCGTA
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Shin H, Braendle C, Monahan KB, Kaplan REW, Zand TP, Mote FS, Peters EC, Reiner DJ. Developmental fidelity is imposed by genetically separable RalGEF activities that mediate opposing signals. PLoS Genet 2019 15(5) e1008056  [ PubMed ID = 31086367 ] [ RRC reference ] Reiner DJ, Lundquist EA. Small GTPases. WormBook 2018 2018 1-65  [ PubMed ID = 27218782 ] [ RRC reference ] Zand TP, Reiner DJ, Der CJ. Ras effector switching promotes divergent cell fates in C. elegans vulval patterning. Dev Cell 2011 20(1) 84-96  [ PubMed ID = 21238927 ] [ RRC reference ]