Mutants (Isolated)

tm2739

Allele Nametm2739
Sequence NameT05E11.6
CGC NameT05E11.6
Worm BaseAllele Name tm2739
CGC Name T05E11.6
Sequence T05E11.6
Phenotypelehtal or sterile
Mutation site6202/6203-6348/6349 (146 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(5297..5421, 5572..5687, 5736..5894, 5949..6151, 6204..6342, 6388..6549, 6652..6716))
Map position4.87
BalancernT1 [qIs51]
Map position of balancer
Sequence of primersIntFwd:GCCACACCTATCGATAACGT,ExtRev:TACGCGTAGAACATGCGCTC,IntRev:ACATGCGCTCCACCGCAATA,ExtFwd:TAGTGGGACTAGTTCTAGGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Ihara S, Nakayama S, Murakami Y, Suzuki E, Asakawa M, Kinoshita T, Sawa H.
PIGN prevents protein aggregation in the endoplasmic reticulum independently of its function in the GPI synthesis.
J Cell Sci 2017 130(3) 602-613 
[ PubMed ID = 27980068 ] [ RRC reference ]

C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25 
[ PubMed ID = 23173093 ] [ RRC reference ]