Home > Mutants (Isolated) > tm2729

Mutants (Isolated)

Allele Name		tm2729
Allele Type		Normal
Sequence Name		F41B4.4
Gene Name		glr-6
Worm Base	Allele Name	tm2729
	Gene Name	glr-6
	Sequence	F41B4.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. K. Ashrafi: normal Nile Red staining.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		17961/17962-18336/18337 (375 bp deletion)
Chromosome		X
Putative gene structure		complement(join(17687..17918, 17965..18183, 18240..18427, 18475..18580, 18624..18800, 19257..19750, 19798..19902, 20293..20409, 20461..20755, 21119..21355, 21428..21563, 21611..21772, 21816..21882))
Map position		-2.35
Balancer
Map position of balancer
Sequence of primers		ExtRev:ATATAGACGCGCAAGCTTAC,IntFwd:GCGCCCAGAGCAGTTTGTAA,ExtFwd:TCCACTTCCAAGAGCGAGGA,IntRev:TTTCTGCGATTGCCACCGTA
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Lin C, Shan Y, Wang Z, Peng H, Li R, Wang P, He J, Shen W, Wu Z, Guo M. Molecular and circuit mechanisms underlying avoidance of rapid cooling stimuli in C. elegans. Nat Commun 2024 15(1) 297  [ PubMed ID = 38182628 ] [ RRC reference ] Liu H, Wu JJ, Li R, Wang PZ, Huang JH, Xu Y, Zhao JL, Wu PP, Li SJ, Wu ZX. Disexcitation in the ASH/RIM/ADL negative feedback circuit fine-tunes hyperosmotic sensation and avoidance in Caenorhabditis elegans. Front Mol Neurosci 2023 16 1101628  [ PubMed ID = 37008778 ] [ RRC reference ] Wang M, Witvliet D, Wu M, Kang L, Shao Z. Temperature regulates synaptic subcellular specificity mediated by inhibitory glutamate signaling. PLoS Genet 2021 17(1) e1009295  [ PubMed ID = 33428618 ] [ RRC reference ] Wen X, Chen YH, Li R, Ge MH, Yin SW, Wu JJ, Huang JH, Liu H, Wang PZ, Gross E, Wu ZX. Signal Decoding for Glutamate Modulating Egg Laying Oppositely in Caenorhabditiselegans under Varied Environmental Conditions. iScience 2020 23(10) 101588  [ PubMed ID = 33089099 ] [ RRC reference ] Hardaway JA, Sturgeon SM, Snarrenberg CL, Li Z, Xu XZ, Bermingham DP, Odiase P, Spencer WC, Miller DM 3rd, Carvelli L, Hardie SL, Blakely RD. Glial Expression of the Caenorhabditis elegans Gene swip-10 Supports Glutamate Dependent Control of Extrasynaptic Dopamine Signaling. J Neurosci 2015 35(25) 9409-23  [ PubMed ID = 26109664 ] [ RRC reference ]