Mutants (Isolated)

tm2723

Allele Nametm2723
Sequence NameW10D5.3
CGC Namegei-17
Worm BaseAllele Name tm2723
CGC Name gei-17
Sequence W10D5.3
Phenotypelethal or sterile
Mutation site15326/15327-15539/15540 (213 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(12109..12167, 12772..12937, 13575..13831, 13933..14246, 14983..15455, 15540..15636, 15682..15776, 15833..15958, 16794..16994, 17936..17988, 18038..18158, 18241..18276, 18402..18473))
Map position3.56
BalancerhT2
Map position of balancer
Sequence of primersIntRev:TACAGTTCGCTCACACGAGT,IntFwd:GAGGGAACGGTATCTAAGAG,ExtRev:TTGCGCGGCATGTGTTATAC,ExtFwd:CGAAGTGAGGGAACGGTATC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Chen SY, Ho CT, Liu WW, Lucanic M, Shih HM, Huang PH, Cheng HJ.
Regulation of axon repulsion by MAX-1 SUMOylation and AP-3.
Proc Natl Acad Sci U S A 2018 115(35) E8236-E8245 
[ PubMed ID = 30104385 ] [ RRC reference ]

Pelisch F, Tammsalu T, Wang B, Jaffray EG, Gartner A, Hay RT.
A SUMO-Dependent Protein Network Regulates Chromosome Congression during Oocyte Meiosis.
Mol Cell 2017 65(1) 66-77 
[ PubMed ID = 27939944 ] [ RRC reference ]

Pelisch F, Sonneville R, Pourkarimi E, Agostinho A, Blow JJ, Gartner A, Hay RT.
Erratum: Dynamic SUMO modification regulates mitotic chromosome assembly and cell cycle progression in Caenorhabditis elegans.
Nat Commun 2015 6 6352 
[ PubMed ID = 25672768 ] [ RRC reference ]