Home > Mutants (Isolated) > tm2723

Mutants (Isolated)

Allele Name		tm2723
Allele Type		Balanced
Sequence Name		W10D5.3
Gene Name		gei-17
Worm Base	Allele Name	tm2723
	Gene Name	gei-17
	Sequence	W10D5.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		15326/15327-15539/15540 (213 bp deletion)
Chromosome		I
Putative gene structure		complement(join(12109..12167, 12772..12937, 13575..13831, 13933..14246, 14983..15455, 15540..15636, 15682..15776, 15833..15958, 16794..16994, 17936..17988, 18038..18158, 18241..18276, 18402..18473))
Map position		3.56
Balancer		hT2,hT2 [bli-4(e937) let-? qIs48]
Map position of balancer
Sequence of primers		IntRev:TACAGTTCGCTCACACGAGT,IntFwd:GAGGGAACGGTATCTAAGAG,ExtRev:TTGCGCGGCATGTGTTATAC,ExtFwd:CGAAGTGAGGGAACGGTATC
Distributed lab
Depositor		Dr. S. Mitani
References		Please submit your publication Kim H, Ding YH, Lu S, Zuo MQ, Tan W, Conte D Jr, Dong MQ, Mello CC. PIE-1 SUMOylation promotes germline fates and piRNA-dependent silencing in C. elegans. Elife 2021 10   [ PubMed ID = 34003111 ] [ RRC reference ] Chen SY, Ho CT, Liu WW, Lucanic M, Shih HM, Huang PH, Cheng HJ. Regulation of axon repulsion by MAX-1 SUMOylation and AP-3. Proc Natl Acad Sci U S A 2018 115(35) E8236-E8245  [ PubMed ID = 30104385 ] [ RRC reference ] Pelisch F, Tammsalu T, Wang B, Jaffray EG, Gartner A, Hay RT. A SUMO-Dependent Protein Network Regulates Chromosome Congression during Oocyte Meiosis. Mol Cell 2017 65(1) 66-77  [ PubMed ID = 27939944 ] [ RRC reference ] Pelisch F, Sonneville R, Pourkarimi E, Agostinho A, Blow JJ, Gartner A, Hay RT. Erratum: Dynamic SUMO modification regulates mitotic chromosome assembly and cell cycle progression in Caenorhabditis elegans. Nat Commun 2015 6 6352  [ PubMed ID = 25672768 ] [ RRC reference ]