Mutants (Isolated)

tm2721

Allele Nametm2721
Sequence NameY74C10AR.3
CGC Nameabtm-1
Worm BaseAllele Name tm2721
CGC Name abtm-1
Sequence Y74C10AR.3
Phenotypelethal or sterile
Mutation site[Y74C10AL] 11227/11228-TTTT- [Y74C10AL] 11534/11535 (307 bp deletion + 4 bp insertion)
ChromosomeI
Putative gene structurecomplement(join(<1215..1286,4065..4142,4190..4249))
Map position-8.54
BalancerhT2 [qIs48]
Map position of balancer
Sequence of primersExtRev:AAAGCCGAACTGCACAGATC,IntFwd:CACTCACATTAGGCATAGCA,IntRev:CAGGAGCTCTAATCGGTGTA,ExtFwd:CGAGCCGTCCACTCACATTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
González-Cabo P, Bolinches-Amorós A, Cabello J, Ros S, Moreno S, Baylis HA, Palau F, Vázquez-Manrique RP.
Disruption of the ATP-binding cassette B7 (ABTM-1/ABCB7) induces oxidative stress and premature cell death in Caenorhabditis elegans.
J. Biol. Chem. 2011 286(24) 21304-14 
[ PubMed ID = 21464130 ] [ RRC reference ]

Lowry J, Yochem J, Chuang CH, Sugioka K, Connolly AA, Bowerman B.
High-Throughput Cloning of Temperature-Sensitive Caenorhabditis elegans Mutants with Adult Syncytial Germline Membrane Architecture Defects.
G3 (Bethesda) 2015 5(11) 2241-55 
[ PubMed ID = 26311651 ] [ RRC reference ]

C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25 
[ PubMed ID = 23173093 ] [ RRC reference ]