Mutants (Isolated)

tm2711

Allele Nametm2711
Sequence NameH02I12.8
CGC Namecyp-31A2
Worm BaseAllele Name tm2711
CGC Name cyp-31A2
Sequence H02I12.8
Phenotypehomozygous viable
Mutation site32980/32981-33455/33456 (475 bp deletion)
ChromosomeIV
Putative gene structurejoin(32671..32763, 32810..33210, 33254..33350, 33397..33467, 33540..34087, Z68336.1:5..171, Z68336.1:489..575)
Map position4.98
Balancer
Map position of balancer
Sequence of primersExtFwd:AGGTTTTGCAATGGGGGTCA,ExtRev:CGGGTCGAATACATCAGGAT,IntFwd:CCCCGCTGTACTTCTCGCTA,IntRev:CACGGTGAACAAGGTACAGG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Hoang HD, Prasain JK, Dorand D, Miller MA.
A heterogeneous mixture of F-series prostaglandins promotes sperm guidance in the Caenorhabditis elegans reproductive tract.
PLoS Genet 2013 9(1) e1003271 
[ PubMed ID = 23382703 ] [ RRC reference ]

Benenati G, Penkov S, Müller-Reichert T, Entchev EV, Kurzchalia TV.
Two cytochrome P450s in Caenorhabditis elegans are essential for the organization of eggshell, correct execution of meiosis and the polarization of embryo.
Mech Dev 2009 126(5-6) 382-93 
[ PubMed ID = 19368796 ] [ RRC reference ]

Stein KK, Golden A.
The C. elegans eggshell.
WormBook 2018 2018 1-36 
[ PubMed ID = 26715360 ] [ RRC reference ]