| Allele Name | tm2711 |
| Sequence Name | H02I12.8 |
| CGC Name | cyp-31A2 |
| Worm Base | Allele Name |
tm2711
|
| CGC Name |
cyp-31A2
|
| Sequence |
H02I12.8
|
| Phenotype | homozygous viable |
| Mutation site | 32980/32981-33455/33456 (475 bp deletion) |
| Chromosome | IV |
| Putative gene structure | join(32671..32763, 32810..33210, 33254..33350, 33397..33467, 33540..34087, Z68336.1:5..171, Z68336.1:489..575) |
| Map position | 4.98 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:AGGTTTTGCAATGGGGGTCA,ExtRev:CGGGTCGAATACATCAGGAT,IntFwd:CCCCGCTGTACTTCTCGCTA,IntRev:CACGGTGAACAAGGTACAGG |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Hoang HD, Prasain JK, Dorand D, Miller MA.
A heterogeneous mixture of F-series prostaglandins promotes sperm guidance in the Caenorhabditis elegans reproductive tract.
PLoS Genet 2013 9(1) e1003271
[ PubMed ID = 23382703 ]
[ RRC reference ]
|
Benenati G, Penkov S, Müller-Reichert T, Entchev EV, Kurzchalia TV.
Two cytochrome P450s in Caenorhabditis elegans are essential for the organization of eggshell, correct execution of meiosis and the polarization of embryo.
Mech Dev 2009 126(5-6) 382-93
[ PubMed ID = 19368796 ]
[ RRC reference ]
|
Stein KK, Golden A.
The C. elegans eggshell.
WormBook 2018 2018 1-36
[ PubMed ID = 26715360 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.