Mutants (Isolated)

tm2709

Allele Nametm2709
Sequence NameF42G8.5
CGC NameF42G8.5
Worm BaseAllele Name tm2709
CGC Name F42G8.5
Sequence F42G8.5
Phenotypehomozygous viable. Dr. T. Katada: normal germline proliferation during L1 diapause.
Mutation site22183/22184-22805/22806 (622 bp deletion)
ChromosomeIV
Putative gene structurejoin(21707..21873, 22080..22395, 22750..22880, 22932..23232)
Map position3.62
Balancer
Map position of balancer
Sequence of primersIntRev:TCGTGTCAAGGAATCCAGAT,IntFwd:GACCAATGGCTCAACGTGAT,ExtRev:TGACGGCTGCCTTGATCCTA,ExtFwd:CGATGTACTGAATGTAGCAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Banerjee N, Bhattacharya R, Gorczyca M, Collins KM, Francis MM.
Local neuropeptide signaling modulates serotonergic transmission to shape the temporal organization of C. elegans egg-laying behavior.
PLoS Genet. 2017 13(4) e1006697 
[ PubMed ID = 28384151 ] [ RRC reference ]

Kim H, Pierce-Shimomura JT, Oh HJ, Johnson BE, Goodman MB, McIntire SL.
The dystrophin complex controls bk channel localization and muscle activity in Caenorhabditis elegans.
PLoS Genet. 2009 5(12) e1000780 
[ PubMed ID = 20019812 ] [ RRC reference ]