Mutants (Isolated)

tm2706

Allele Nametm2706
Sequence NameK02G10.4a
CGC Nameflp-11
Worm BaseAllele Name tm2706
CGC Name flp-11
Sequence K02G10.4a
Phenotypehomozygous viable
Mutation site4360/4361-4514/4515 (154 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(4206..4291, 4361..4527, 4583..4662))
Map position-6.9
Balancer
Map position of balancer
Sequence of primersIntRev:GCATTGGCACTTCTCCTTAT,ExtRev:ACGCCCCCTCCTAATACATC,IntFwd:GGTCGTCCTCGGTCATTACT,ExtFwd:TCGCCTCAGGAGTTGTTCGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Maluck E, Busack I, Besseling J, Masurat F, Turek M, Busch KE, Bringmann H.
A wake-active locomotion circuit depolarizes a sleep-active neuron to switch on sleep.
PLoS Biol. 2020 18(2) e3000361 
[ PubMed ID = 32078631 ] [ RRC reference ]

Lee JS, Shih PY, Schaedel ON, Quintero-Cadena P, Rogers AK, Sternberg PW.
FMRFamide-like peptides expand the behavioral repertoire of a densely connected nervous system.
Proc. Natl. Acad. Sci. U.S.A. 2017 114(50) E10726-E10735 
[ PubMed ID = 29167374 ] [ RRC reference ]

Banerjee N, Bhattacharya R, Gorczyca M, Collins KM, Francis MM.
Local neuropeptide signaling modulates serotonergic transmission to shape the temporal organization of C. elegans egg-laying behavior.
PLoS Genet. 2017 13(4) e1006697 
[ PubMed ID = 28384151 ] [ RRC reference ]

Turek M, Besseling J, Spies JP, König S, Bringmann H.
Sleep-active neuron specification and sleep induction require FLP-11 neuropeptides to systemically induce sleep.
Elife 2016 5  
[ PubMed ID = 26949257 ] [ RRC reference ]

Chew YL, Tanizawa Y, Cho Y, Zhao B, Yu AJ, Ardiel EL, Rabinowitch I, Bai J, Rankin CH, Lu H, Beets I, Schafer WR.
An Afferent Neuropeptide System Transmits Mechanosensory Signals Triggering Sensitization and Arousal in C. elegans.
Neuron 2018 99(6) 1233-1246.e6 
[ PubMed ID = 30146306 ] [ RRC reference ]

Yemini E, Jucikas T, Grundy LJ, Brown AE, Schafer WR.
A database of Caenorhabditis elegans behavioral phenotypes.
Nat. Methods 2013 10(9) 877-9 
[ PubMed ID = 23852451 ] [ RRC reference ]

Stawicki TM, Takayanagi-Kiya S, Zhou K, Jin Y.
Neuropeptides function in a homeostatic manner to modulate excitation-inhibition imbalance in C. elegans.
PLoS Genet. 2013 9(5) e1003472 
[ PubMed ID = 23658528 ] [ RRC reference ]