Mutants (Isolated)

tm2702

Allele Nametm2702
Sequence NameT13F2.8
CGC Namecav-1
Worm BaseAllele Name tm2702
CGC Name cav-1
Sequence T13F2.8
Phenotypehomozygous viable
Mutation site7543/7544-7830/7831 (287 bp deletion)
ChromosomeIV
Putative gene structurejoin(7442..7717, 7843..8274)
Map position4.41
Balancer
Map position of balancer
Sequence of primersExtRev:CGGATCGTTATTACCACTCT,IntFwd:TCCACTGACATACGCTGCAG,IntRev:TTTAGACGCATGGAGCAGTA,ExtFwd:TGTCCACCGAGCAAGATATC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Roitenberg N, Bejerano-Sagie M, Boocholez H, Moll L, Marques FC, Golodetzki L, Nevo Y, Elami T, Cohen E.
Modulation of caveolae by insulin/IGF-1 signaling regulates aging of Caenorhabditis elegans.
EMBO Rep 2018 19(8)  
[ PubMed ID = 29945933 ] [ RRC reference ]