Mutants (Isolated)

tm2701

Allele Nametm2701
Sequence NameY43B11AR.2
CGC Namesrg-50
Worm BaseAllele Name tm2701
CGC Name srg-50
Sequence Y43B11AR.2
Phenotypehomozygous viable
Mutation site3926/3927-AAACTATTACGAAAACTTGAAATCTAC-4368/4369 (442 bp deletion + 27 bp insertion)
ChromosomeIV
Putative gene structurecomplement(join(3353..3499, 3606..3878, 4004..4486))
Map position3.3
Balancer
Map position of balancer
Sequence of primersExtFwd:TAGACACGGCAGAAGTAGTA,IntFwd:CGCCATTGAGAATGAGACCT,ExtRev:CTGTCTCCGATTTCGCTCTA,IntRev:CGGCGCGTTAAAGCTCATAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Geffeney SL, Cueva JG, Glauser DA, Doll JC, Lee TH, Montoya M, Karania S, Garakani AM, Pruitt BL, Goodman MB.
DEG/ENaC but not TRP channels are the major mechanoelectrical transduction channels in a C. elegans nociceptor.
Neuron 2011 71(5) 845-57 
[ PubMed ID = 21903078 ] [ RRC reference ]